View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5465_low_5 (Length: 414)
Name: NF5465_low_5
Description: NF5465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5465_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 271; Significance: 1e-151; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 19 - 297
Target Start/End: Complemental strand, 44854081 - 44853803
Alignment:
| Q |
19 |
cagagaagcaacgcgggaaaactccatcacagtcacgaccgagcataatgccggagctaccggaggtagaggcggcgagaagagcggcggaagagaactg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44854081 |
cagagaagcaacgcgggaaaactccatcacagtcacgaccgagcataatgccggagctaccggaggtagaggcggcgagaagagcggtggaagagaactg |
44853982 |
T |
 |
| Q |
119 |
tatcggaaagaagataaccaaatgcatcgttgccgatgataacaaagtcatcgacggtgtctctcgcgaagagttcgaagcttccgttgttgggaagaag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44853981 |
tatcggaaagaagataaccaaatgcatcgtcgccgatgataacaaagtcatcgacggtgtctctcgcgaagagttcgaagcttccgttgttgggaagaag |
44853882 |
T |
 |
| Q |
219 |
attgttgcagctcgccggaaggggaagaatatgtggcttcagcttgattctcctccttttccttcctttcaattcggta |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44853881 |
attgttgcagctcgccggaaggggaagaatatgtggcttcagcttgattctcctccttttccttcctttcaattcggta |
44853803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 326 - 398
Target Start/End: Complemental strand, 44853758 - 44853686
Alignment:
| Q |
326 |
taccttttgaaaccctagcttacgagtttcttacgatttatgattgtgactgtgttaggtatggctggtgctg |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44853758 |
taccttttgaaaccctagcttacgagtttcttacgatttatgattgtgactgtgttaggtatggctggtgctg |
44853686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University