View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5466-Insertion-7 (Length: 112)
Name: NF5466-Insertion-7
Description: NF5466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5466-Insertion-7 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 102; Significance: 4e-51; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 102; E-Value: 4e-51
Query Start/End: Original strand, 7 - 112
Target Start/End: Complemental strand, 6753129 - 6753024
Alignment:
| Q |
7 |
aaatagttatctataatctcgatatcatatgtgcaattttgagattttaatatccatatccctccagagtgtccacgagcttcagaaattgcacaatcct |
106 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6753129 |
aaatagttatctataatctcaatatcatatgtgcaattttgagattttaatatccatatccctccagagtgtccacgagcttcagaaattgcacaatcct |
6753030 |
T |
 |
| Q |
107 |
catagc |
112 |
Q |
| |
|
|||||| |
|
|
| T |
6753029 |
catagc |
6753024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 94; Significance: 2e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 2e-46
Query Start/End: Original strand, 7 - 112
Target Start/End: Original strand, 1811405 - 1811510
Alignment:
| Q |
7 |
aaatagttatctataatctcgatatcatatgtgcaattttgagattttaatatccatatccctccagagtgtccacgagcttcagaaattgcacaatcct |
106 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
1811405 |
aaatagttatctataatctcaatatcatatgtgcaattttgagattttaatatccatatacctccagagtgtccacgagcttcagaaattgcacaattct |
1811504 |
T |
 |
| Q |
107 |
catagc |
112 |
Q |
| |
|
|||||| |
|
|
| T |
1811505 |
catagc |
1811510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University