View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5466_high_9 (Length: 288)
Name: NF5466_high_9
Description: NF5466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5466_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 101 - 273
Target Start/End: Original strand, 1028139 - 1028302
Alignment:
| Q |
101 |
gcatgagatagcaaagacacgtacaatcaccacaacatttattcattaataataatagtagcagtagttcat-----cggagcggagcggaagctagttg |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1028139 |
gcatgagatagcaaagacacgtacaatcaccacaacgtttattcattaataataatagtagcagtagttcatcggagcggagcggagcggaagctagttg |
1028238 |
T |
 |
| Q |
196 |
gtggaggttgcaggcggagcgggaggagcggagttaggtgggatatcaacggtgttatcatcaccatcaccaccattg |
273 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
1028239 |
gtggaggctgcag--------------gcggagttaggtgggatatgaacggtggtatcatcaccatcaccaccattg |
1028302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 54
Target Start/End: Original strand, 1028054 - 1028092
Alignment:
| Q |
16 |
atgtttaatatagacattatttaccaattttgaaagatc |
54 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
1028054 |
atgtttaatatagacattatttatcaattttaaaagatc |
1028092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University