View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5466_low_13 (Length: 261)
Name: NF5466_low_13
Description: NF5466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5466_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 170 - 251
Target Start/End: Complemental strand, 34392278 - 34392197
Alignment:
| Q |
170 |
gaagttacacttgaccccctattttgaatgaaattggattataaccccctattttaaaattcaaattgttttaacccctatg |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34392278 |
gaagttacacttgaccccctattttgaatgaaattggactataaccccctattttaaaattcaatttgttttaacccctatg |
34392197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 51 - 104
Target Start/End: Complemental strand, 34392397 - 34392344
Alignment:
| Q |
51 |
gtgagtctatttacttttgtaatatgaaaattgtgtttttggggctttgttccc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34392397 |
gtgagtctatttacttttgtaatatgaaaattgtgtttttggggctttgttccc |
34392344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University