View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5466_low_13 (Length: 261)

Name: NF5466_low_13
Description: NF5466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5466_low_13
NF5466_low_13
[»] chr5 (2 HSPs)
chr5 (170-251)||(34392197-34392278)
chr5 (51-104)||(34392344-34392397)


Alignment Details
Target: chr5 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 170 - 251
Target Start/End: Complemental strand, 34392278 - 34392197
Alignment:
170 gaagttacacttgaccccctattttgaatgaaattggattataaccccctattttaaaattcaaattgttttaacccctatg 251  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||    
34392278 gaagttacacttgaccccctattttgaatgaaattggactataaccccctattttaaaattcaatttgttttaacccctatg 34392197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 51 - 104
Target Start/End: Complemental strand, 34392397 - 34392344
Alignment:
51 gtgagtctatttacttttgtaatatgaaaattgtgtttttggggctttgttccc 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34392397 gtgagtctatttacttttgtaatatgaaaattgtgtttttggggctttgttccc 34392344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University