View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5466_low_16 (Length: 249)
Name: NF5466_low_16
Description: NF5466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5466_low_16 |
 |  |
|
| [»] scaffold0147 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0147 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 13539 - 13770
Alignment:
| Q |
1 |
cattgtccatattacaaaggaaattgaaggaaagagatcttggaagtttttggtaccctccagagaaaaaagacctgaaattttttagccttttgttaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13539 |
cattgtccatattacaaaggaaattgaaggaaagagatcttggaagtttttggtaccctccagagaaaaaagacctgaagttttttagccttttgttaaa |
13638 |
T |
 |
| Q |
101 |
gaaacttttggtcttgtgaatggtttttcttaggtgcaccattgtgaaagaatgtggctctctctaaatggcgttgtcttctagagctgtcatagtttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13639 |
gaaacttttggtcttgtgaatggtttttcttaggtgcaccattgtgaaagaatgtggctctctctaaatggcgttgtcttctagagctgtcatagtttta |
13738 |
T |
 |
| Q |
201 |
atctggtttagctcttgtataatctccaattt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
13739 |
atctggtttagctcttgtataatctccaattt |
13770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University