View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5466_low_6 (Length: 381)
Name: NF5466_low_6
Description: NF5466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5466_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 11 - 362
Target Start/End: Complemental strand, 1782264 - 1781913
Alignment:
| Q |
11 |
cacagatccacccttttcttgtgtttttctcactttcagatgcgaggaggatgaagtgggggaaaaactacttgatgttaattgtgaaatttgattaaac |
110 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1782264 |
cacagatcaaccctcttcttgtgtttttctcaccttcagatgcgaggaggatgaagtgggggaaaaactacttgatgttaattgtgaaatttaattaaac |
1782165 |
T |
 |
| Q |
111 |
ttatgacctggtggattggacttttttggactatatgctgggaaggtttggttttggattaaatggatgaagacttgtatttgtacaaataatttgttag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1782164 |
ttatgacctggtggattggacttttttggactatatgctgggaaggtttggttttggattaaatggatgaagacttgtatttgtacaaataatttgttag |
1782065 |
T |
 |
| Q |
211 |
ttttggtaattggttgtcctataggggaaatctcgacaaagaggcctaaacaaggagacccccttgctactttattatttctcttggtagtgaaaagttt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1782064 |
ttttggtaattggttgtcctataggggaaatctcgacaaagaggcctaaacaaggagacccccttgctactttattatttctcttggtagtgaaaagttt |
1781965 |
T |
 |
| Q |
311 |
tgagggtctcacgaagtcagcatgtaggatgtacatgttcaaaggttatgtg |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1781964 |
tgagggtctcacgaagtcagcatgtaggatgtacatgttcaaaggttatgtg |
1781913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University