View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5466_low_9 (Length: 304)
Name: NF5466_low_9
Description: NF5466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5466_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 60 - 278
Target Start/End: Original strand, 26072809 - 26073027
Alignment:
| Q |
60 |
aacatgggaactggttcatcaaagcaaacagatggtaattcagaagaaaccaaagacagaacagatgatgatgatgagcaagctggtggacaactatatg |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26072809 |
aacatgggaactggttcatcaaagcaaacagatggtacttcagaagaaaccaaagacagaacagatgatgatgatgatcaagctggtggacaactatatg |
26072908 |
T |
 |
| Q |
160 |
tttctctcaagatggagaatctcaaactcactactcatcttgttcctcatgtttatggttctgttcctcttgttggttcttgggattcttccaaagctgt |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26072909 |
tttctctcaagatggagaatctcaaactcactactcatcttgttcctcatgtttatggttctgttcctcttgttggttcttgggattcttccaaagctgt |
26073008 |
T |
 |
| Q |
260 |
aattttcatcactcttatg |
278 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
26073009 |
aattttcatcactcttatg |
26073027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University