View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5467-Insertion-1 (Length: 313)
Name: NF5467-Insertion-1
Description: NF5467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5467-Insertion-1 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 4 - 313
Target Start/End: Complemental strand, 30419078 - 30418769
Alignment:
| Q |
4 |
aacaaaaacaacaagagaatgaagattcctccaacggaatcagagtccaaggaatgcaattctcctacaacgacatccaacaacaacaaccaccgctctt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30419078 |
aacaaaaacaacaagagaatgaagattcctccaacggaatcagagtccaaggaatgcaattctcctacaacgacatccaacaacaacaaccaccgctctt |
30418979 |
T |
 |
| Q |
104 |
cgtcgatttcaacctccaagtttctcccggatccagatgcctcctcgtcggtgctaacggatccggtaaaacgaccttgctgaagattctggcggggaag |
203 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30418978 |
cgtcgatttcaacctccaagtttctccaggatccagatgcctcctcgtcggtgctaacggatccggtaaaacgactttgctgaagattctggcggggaag |
30418879 |
T |
 |
| Q |
204 |
catatggttggaggaaaagacgttgtccgtgtcttgaattgttctgcttttcatgatactcagcttgtttgtagtggtgatcttgcttatttgggtggat |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30418878 |
catatggttggaggaaaagacgttgtccgtgtcttgaattgttctgcttttcatgatactcagcttgtttgtagtggtgatcttgcttatttgggtggat |
30418779 |
T |
 |
| Q |
304 |
cttggagcaa |
313 |
Q |
| |
|
|||||||||| |
|
|
| T |
30418778 |
cttggagcaa |
30418769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University