View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5468-Insertion-8 (Length: 145)
Name: NF5468-Insertion-8
Description: NF5468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5468-Insertion-8 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
| [»] chr7 (3 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 4e-61; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 4e-61
Query Start/End: Original strand, 15 - 145
Target Start/End: Complemental strand, 41311322 - 41311193
Alignment:
| Q |
15 |
gagtttgattctgatttgccttataagaatactggcaagctctaatggtggtcccagagttgggtcgttcttgaatggttctattcattggctgatttat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41311322 |
gagtttgattctgatttgccttataagaatactg-caagctctaatggtggtcccagagttgggtcgttcttgaatggttctattcattggctggtttat |
41311224 |
T |
|
| Q |
115 |
gatgataagactgaaatggatgttattattg |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41311223 |
gatgataagactgaaatggatgttattattg |
41311193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 4e-30
Query Start/End: Original strand, 15 - 145
Target Start/End: Complemental strand, 43165000 - 43164871
Alignment:
| Q |
15 |
gagtttgattctgatttgccttataagaatactggcaagctctaatggtggtcccagagttgggtcgttcttgaatggttctattcattggctgatttat |
114 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||| || | |||| ||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43165000 |
gagtttgattctgatttgccttattggaatactga-aagacctgaaggtgctcccagagtcgggtcgttcttgaatggttctattcattggctggtttat |
43164902 |
T |
|
| Q |
115 |
gatgataagactgaaatggatgttattattg |
145 |
Q |
| |
|
|| || |||||||||| ||||||||||||| |
|
|
| T |
43164901 |
aattatgagactgaaatagatgttattattg |
43164871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 72; Significance: 4e-33; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 72; E-Value: 4e-33
Query Start/End: Original strand, 18 - 145
Target Start/End: Original strand, 30165608 - 30165734
Alignment:
| Q |
18 |
tttgattctgatttgccttataagaatactggcaagctctaatggtggtcccagagttgggtcgttcttgaatggttctattcattggctgatttatgat |
117 |
Q |
| |
|
||||||||| |||||||||||| ||| ||| || ||||| | |||||||||||||||||||||||||| ||||||||||||||||||||| ||||| || |
|
|
| T |
30165608 |
tttgattctcatttgccttataggaaccctg-catgctctgaaggtggtcccagagttgggtcgttcttcaatggttctattcattggctggtttataat |
30165706 |
T |
|
| Q |
118 |
gataagactgaaatggatgttattattg |
145 |
Q |
| |
|
|| |||||||||||||||||||||||| |
|
|
| T |
30165707 |
tatcagactgaaatggatgttattattg |
30165734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 15 - 108
Target Start/End: Complemental strand, 30125276 - 30125184
Alignment:
| Q |
15 |
gagtttgattctgatttgccttataagaatactggcaagctctaatggtggtcccagagttgggtcgttcttgaatggttctattcattggctg |
108 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||| | ||||||| || | ||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
30125276 |
gagtttgattctcatttgccttataggaatactg-ctcgctctaacggatggcccagagttgggttgttcttgaatgggactattcattggctg |
30125184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 68 - 143
Target Start/End: Complemental strand, 30131178 - 30131103
Alignment:
| Q |
68 |
ccagagttgggtcgttcttgaatggttctattcattggctgatttatgatgataagactgaaatggatgttattat |
143 |
Q |
| |
|
||||||| |||| |||||||||||| |||||||||||||| ||||| || || |||| || |||||||||||| |
|
|
| T |
30131178 |
ccagagtcgggttgttcttgaatggggctattcattggctggtttataattatgagacaagaagggatgttattat |
30131103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University