View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5468-Insertion-9 (Length: 114)
Name: NF5468-Insertion-9
Description: NF5468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5468-Insertion-9 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 85; Significance: 5e-41; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 85; E-Value: 5e-41
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 16697664 - 16697556
Alignment:
| Q |
8 |
ttcagttatgttaaaagaatgggacaaagtatcattgaaagaa-tgattgtcccactccttagaagaagaga-agcttgaaaaatggtgatgataacttg |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
16697664 |
ttcagttatgttaaaagaatgggacaaagtatcattgaaagaattgattgtcctactccttagaagaagagatagcttgaaaaatggtgataataacttg |
16697565 |
T |
|
| Q |
106 |
aaatttggg |
114 |
Q |
| |
|
||||||||| |
|
|
| T |
16697564 |
aaatttggg |
16697556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University