View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5468_high_18 (Length: 288)
Name: NF5468_high_18
Description: NF5468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5468_high_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 21872254 - 21872461
Alignment:
| Q |
1 |
gaagaagaagtgtagtaggagaagaaggggtattgttattgttctcagaacgacgtcgtttaaggtagagttgaagaaagtaaaagagtgataaagggat |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21872254 |
gaagaagaagcgtagtaggagaagaaggagtattgttattgttctcagaacgacgtcgtttaaggtagagttgaagaaagtaaaagagtgacaaagggat |
21872353 |
T |
 |
| Q |
101 |
taaactaccgaggagaaaaccgttgcgaccttgaactacggcttgaagaggaacgataagtttcattccggttcgagaggatgaagaagaagaggaaggt |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21872354 |
taaactacccaggagaaaaccgttgcgaccttgaactacggcttgaagaggaacgataagtttcattccggttcgagaggatgaagaagaagaggaaggt |
21872453 |
T |
 |
| Q |
201 |
ggttcaga |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
21872454 |
ggttcaga |
21872461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University