View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5468_low_23 (Length: 287)
Name: NF5468_low_23
Description: NF5468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5468_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 260; Significance: 1e-145; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 268
Target Start/End: Original strand, 12320048 - 12320315
Alignment:
| Q |
1 |
gtgattgttggaggtggtatatgtggccttgcaacagccctagcacttcataggttttattattatgcaagccaaatttatttatatataaaactttgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12320048 |
gtgattgttggaggtggtatatgtggccttgcaacagccctagcacttcataggttttattattatgcaagccaaatttatttatatataaaactttgat |
12320147 |
T |
 |
| Q |
101 |
atgatcttataagataagattacattttcactaactttgcaggaagagaataaagagtttggtgttagaaagatcagaggagttgagagctacaggtgca |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12320148 |
atgatattataagataagattacattttcactaactttgcaggaagagaataaagagtttggtgttagaaagatcagaggagttgagagctacaggtgca |
12320247 |
T |
 |
| Q |
201 |
gctataattgttcaagctaatggatggcatgcacttgatcagcttggtgttggttcaatacttagaga |
268 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12320248 |
gctataattgtgcaagctaatggatggcatgcacttgatcagcttggtgttggttcaatacttagaga |
12320315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 74 - 268
Target Start/End: Original strand, 12311971 - 12312165
Alignment:
| Q |
74 |
aaatttatttatatataaaactttgatatgatcttataagataagattacattttcactaactttgcaggaagagaataaagagtttggtgttagaaaga |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| ||||||||||||||||| |||||||||||||||||||||| | |
|
|
| T |
12311971 |
aaatttatttatatataaaactttgatatgatcttatgagataagattatattttcattaactttgcaggaagagtataaagagtttggtgttagaaaaa |
12312070 |
T |
 |
| Q |
174 |
tcagaggagttgagagctacaggtgcagctataattgttcaagctaatggatggcatgcacttgatcagcttggtgttggttcaatacttagaga |
268 |
Q |
| |
|
|||||||| ||| |||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12312071 |
tcagaggaattgcgagccacaggggcagctataattgttcaagctaatggatggcatgcacttgatcagcttggtgttggttcaatacttagaga |
12312165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 12311718 - 12311795
Alignment:
| Q |
1 |
gtgattgttggaggtggtatatgtggccttgcaacagccctagcacttcataggttttattattatgcaagccaaatttat |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| ||||||| ||||||||| |
|
|
| T |
12311718 |
gtgattgttggaggtggtatatgtggccttgcaacagccctagcgcttcataggttctatt---atgcaagtcaaatttat |
12311795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University