View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5468_low_24 (Length: 283)
Name: NF5468_low_24
Description: NF5468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5468_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 264
Target Start/End: Original strand, 12843862 - 12844108
Alignment:
| Q |
18 |
agaaaattgcagagactgaccggaatcatatctgcgcgagagaggtggaagataagacagctgccactgatgcataactgtagcgtgtcggcgggaggat |
117 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12843862 |
agaaagttgcagagactaaccggaatcatatcggcgagagagaggtggaagataagacagctgccactgatgcataactgtagcgtgtcggcgggaggat |
12843961 |
T |
 |
| Q |
118 |
caaggttgccgggagtccattgaacgccaaggccgacaacgagattacggttacggagattacggttgcggcgaaggtattgaaggtggcggagggattg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12843962 |
caaggttgccgggagtccattgaacgccaaggccgacaatgagattacggttacagagattacggttgcggcgaaggtattgaaggtggcggagggattg |
12844061 |
T |
 |
| Q |
218 |
aaaatgatgattgagcatactttggagccagtttgttacgacggaag |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12844062 |
aaaatgatgattgagcatactttggagccagtttgttacgacggaag |
12844108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 18 - 175
Target Start/End: Complemental strand, 12861619 - 12861462
Alignment:
| Q |
18 |
agaaaattgcagagactgaccggaatcatatctgcgcgagagaggtggaagataagacagctgccactgatgcataactgtagcgtgtcggcgggaggat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12861619 |
agaaaattgcagagactgaccggaatcatatctgcgcgagagaggtggaagataagacagctgccaccgatgcataactgtagcgtgtcggcgggaggat |
12861520 |
T |
 |
| Q |
118 |
caaggttgccgggagtccattgaacgccaaggccgacaacgagattacggttacggag |
175 |
Q |
| |
|
||||||||| | ||||||||||||||| ||||||||||| ||||||| ||| ||||| |
|
|
| T |
12861519 |
caaggttgcggttagtccattgaacgccgaggccgacaacaagattacagttgcggag |
12861462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University