View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5468_low_35 (Length: 250)
Name: NF5468_low_35
Description: NF5468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5468_low_35 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 21872182 - 21872055
Alignment:
| Q |
1 |
aatgttgttgccaaacgtgatgattctctttattatgttggaattgaaagagttgagaaagatccttatcatgttaagtttaatcctaatgggattattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21872182 |
aatgttgttgccaaacgtgatgattctctttattatgttggaattgaaagagttgagaaagatccttatcatgttaagtttaatcctaatgggattattc |
21872083 |
T |
|
| Q |
101 |
agcttggtttgtctgataacaaggtcag |
128 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
21872082 |
agcttggtttgtctgataacaaggtcag |
21872055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 204 - 237
Target Start/End: Complemental strand, 21871977 - 21871944
Alignment:
| Q |
204 |
aaaaataaatgtttgccattacttttcccaccct |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
21871977 |
aaaaataaatgtttgccattacttttcccaccct |
21871944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University