View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5468_low_36 (Length: 241)
Name: NF5468_low_36
Description: NF5468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5468_low_36 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 38 - 241
Target Start/End: Complemental strand, 38016097 - 38015900
Alignment:
| Q |
38 |
ttcaagcaatttctgattcatgaaatgctactaattgtgatccaaaatatgtcttaaaacatcatactaaatgcaactttacaaatggcactatggaagt |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38016097 |
ttcaagcaatttctgattcatgaaatgctactaattgtgatccaaaatatgtcttaaaacatcctactaaatgcaactttacaaatggcactatggaagt |
38015998 |
T |
 |
| Q |
138 |
atgtgaatgttgtgaaaacttttactcacttggagcctgtagcacttgcaaaattttatcatggaa---agctacaatcgagtggctgcacctgcttcgt |
234 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
38015997 |
atg---------tgaaaacttttactcacttggagcctgtagcacttgcaaaattttatcatggaaagcagctacaatcgaatggctgcacctgcttcgt |
38015907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University