View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5468_low_36 (Length: 241)

Name: NF5468_low_36
Description: NF5468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5468_low_36
NF5468_low_36
[»] chr8 (1 HSPs)
chr8 (38-241)||(38015900-38016097)


Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 38 - 241
Target Start/End: Complemental strand, 38016097 - 38015900
Alignment:
38 ttcaagcaatttctgattcatgaaatgctactaattgtgatccaaaatatgtcttaaaacatcatactaaatgcaactttacaaatggcactatggaagt 137  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
38016097 ttcaagcaatttctgattcatgaaatgctactaattgtgatccaaaatatgtcttaaaacatcctactaaatgcaactttacaaatggcactatggaagt 38015998  T
138 atgtgaatgttgtgaaaacttttactcacttggagcctgtagcacttgcaaaattttatcatggaa---agctacaatcgagtggctgcacctgcttcgt 234  Q
    |||         ||||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||| ||||||||||||||||||    
38015997 atg---------tgaaaacttttactcacttggagcctgtagcacttgcaaaattttatcatggaaagcagctacaatcgaatggctgcacctgcttcgt 38015907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University