View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5468_low_37 (Length: 240)
Name: NF5468_low_37
Description: NF5468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5468_low_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 11 - 223
Target Start/End: Complemental strand, 3533129 - 3532917
Alignment:
| Q |
11 |
aattatactttgcattggcaccaaaagtgacaacgaccttcgtgtctactttgttgtttgcaccaaataagcttttcttggcatttgcgatgccttacgg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3533129 |
aattatactttgcattggcaccaaaagtgacaacgaccttcgtgtctactttgttgtttgcaccaaataagcttttcttggcatttgcgatgccttacgg |
3533030 |
T |
 |
| Q |
111 |
tacaagattggctattattttttgcaagacaattgcaatgtcaaatagaacatcgtagagggaaagcatttcctcattcaagccaattctagtggcatcc |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3533029 |
tacaagattggctattattgtttgcaagacaattgcaatgtcaaatagaacatcgaagagggaaagcatttcctcattcaagccaattctagtgacatcc |
3532930 |
T |
 |
| Q |
211 |
atatatatgttat |
223 |
Q |
| |
|
||||||||||||| |
|
|
| T |
3532929 |
atatatatgttat |
3532917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University