View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5468_low_7 (Length: 430)

Name: NF5468_low_7
Description: NF5468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5468_low_7
NF5468_low_7
[»] chr8 (2 HSPs)
chr8 (250-312)||(4638456-4638518)
chr8 (376-430)||(4638590-4638644)


Alignment Details
Target: chr8 (Bit Score: 59; Significance: 7e-25; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 250 - 312
Target Start/End: Original strand, 4638456 - 4638518
Alignment:
250 gaaccctgaccttgaaaattaatggcaaacgaaccagaggaagaagatgaattacaaccttag 312  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
4638456 gaaccctgaccttgaaaattaatggcaaacgaacctgaggaagaagatgaattacaaccttag 4638518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 376 - 430
Target Start/End: Original strand, 4638590 - 4638644
Alignment:
376 ggaaccggaccagaacctgttgtggagaaagaaaagggtaccggactcaagtgat 430  Q
    |||||| ||||||||||||||||||||||||||||||| ||||||||||||||||    
4638590 ggaaccagaccagaacctgttgtggagaaagaaaagggaaccggactcaagtgat 4638644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University