View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5469-Insertion-3 (Length: 237)
Name: NF5469-Insertion-3
Description: NF5469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5469-Insertion-3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 3e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 3e-80
Query Start/End: Original strand, 54 - 233
Target Start/End: Original strand, 44544069 - 44544251
Alignment:
| Q |
54 |
ataactagactaaaaaatatagagaaaa-ttgatagaaaga-tgtgtacattaattacctatgatgaaaggcatgaccttccagcctctatggatgatct |
151 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44544069 |
ataattagactaaaaaatatagagaaaaattgatagaaagagtgtgtacattaattacctatgatgaaaggcatgaccttccagcctctatggatgatct |
44544168 |
T |
|
| Q |
152 |
taggatcatcatttgtttcatgtttctca-tattttccatgttgttttctttctcagttgtcttccttgttgttccttcttct |
233 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44544169 |
taggatcatcatttgtttcatgtttctcactattttccatgttgttttctttctcagttgtcttcattgttgttccttcttct |
44544251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University