View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5469-Insertion-4 (Length: 155)
Name: NF5469-Insertion-4
Description: NF5469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5469-Insertion-4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 7e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 7e-75
Query Start/End: Original strand, 7 - 152
Target Start/End: Complemental strand, 2794055 - 2793910
Alignment:
| Q |
7 |
aacaaggtgattaaacacagtatcagtgatagggttaagcagtttctcaatgttaatcttcttgtcaccaatagagtcgtttttcagaatggaaagaatc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2794055 |
aacaaggtgattaaacacagtatcagtgatagggttaagcagtttctcaatgttaatcttcttgtcaccaacagagtcgtttttcagaatggaaagaatc |
2793956 |
T |
|
| Q |
107 |
tcatcagcagcacctctgataatcccaagcggctgaccaccaaacc |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2793955 |
tcatcagcagcacctctgataatcccaagcggctgaccaccaaacc |
2793910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 28; Significance: 0.0000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 34 - 73
Target Start/End: Original strand, 29238612 - 29238651
Alignment:
| Q |
34 |
gatagggttaagcagtttctcaatgttaatcttcttgtca |
73 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
29238612 |
gatagggttaagaagcatctcaatgttaatcttcttgtca |
29238651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University