View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5469-Insertion-6 (Length: 90)
Name: NF5469-Insertion-6
Description: NF5469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5469-Insertion-6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 40; Significance: 0.00000000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000003
Query Start/End: Original strand, 7 - 46
Target Start/End: Original strand, 36847366 - 36847405
Alignment:
| Q |
7 |
actattgttggagatgctactattataactctcatctttg |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36847366 |
actattgttggagatgctactattataactctcatctttg |
36847405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University