View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5469_low_3 (Length: 267)
Name: NF5469_low_3
Description: NF5469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5469_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 90; Significance: 1e-43; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 144 - 253
Target Start/End: Complemental strand, 16863109 - 16863000
Alignment:
| Q |
144 |
aaatgttaatatattaattattatgttactatttttctctcttgcctgaacttgaactgtcaaccttgaactcctttagaacaacgtgagaacactgagg |
243 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16863109 |
aaatgttaatatattaattattatgttggtatttttctcgcttgccagaacttgaactgtcaaccttgaactcctttagaacaacgtgagaacagtgagg |
16863010 |
T |
 |
| Q |
244 |
ttgagaaatg |
253 |
Q |
| |
|
|||||||||| |
|
|
| T |
16863009 |
ttgagaaatg |
16863000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 15 - 68
Target Start/End: Complemental strand, 16863163 - 16863110
Alignment:
| Q |
15 |
atcaagaaatcacaacaaaatcttagaagaaacacgagatattcaaacatcaat |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16863163 |
atcaagaaatcacaacaaaatcttagaagaaacgcgagatattcaaacatcaat |
16863110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 144 - 184
Target Start/End: Complemental strand, 12123358 - 12123318
Alignment:
| Q |
144 |
aaatgttaatatattaattattatgttactatttttctctc |
184 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||| |||| |
|
|
| T |
12123358 |
aaatgttaatatattaattattatgttaatttttttttctc |
12123318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 144 - 180
Target Start/End: Complemental strand, 3031155 - 3031119
Alignment:
| Q |
144 |
aaatgttaatatattaattattatgttactatttttc |
180 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
3031155 |
aaatgttaatatattaattgttatgttagtatttttc |
3031119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 144 - 200
Target Start/End: Complemental strand, 25209852 - 25209797
Alignment:
| Q |
144 |
aaatgttaatatattaattattatgttactatttttctctcttgcctgaacttgaac |
200 |
Q |
| |
|
|||||||| ||| ||||||||||||||| |||||||||| |||||| ||||||||| |
|
|
| T |
25209852 |
aaatgttagtatgttaattattatgttagtatttttctc-cttgccaaaacttgaac |
25209797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University