View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5470_low_11 (Length: 243)
Name: NF5470_low_11
Description: NF5470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5470_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 17 - 227
Target Start/End: Original strand, 26260827 - 26261037
Alignment:
| Q |
17 |
taagaacaaaagtgcgtttttacacatctggattttaaaatttagatgtggaatggacttttaacacattcataactgtcttttaaatctggatgggtaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
26260827 |
taagaacaaaagtgcgtttttacacatctggattttaaaatttagatgtggaatggacttttaacacattcataagtgtcttttaaatttggatgggtaa |
26260926 |
T |
|
| Q |
117 |
aaaatcttgaaaataaacttttgttaatgtttttcctttctaaatgtagactttctcataattgtctggagtgtataatccagacaaatagtgtatggat |
216 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
26260927 |
aaaatcttgaaaataaacatttgttaatgtttttcctttctaaatgtagaccttctcataattgtctggagtgtataattcagataaatagtgtatggat |
26261026 |
T |
|
| Q |
217 |
ttcaaaatcca |
227 |
Q |
| |
|
||||||||||| |
|
|
| T |
26261027 |
ttcaaaatcca |
26261037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University