View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5470_low_4 (Length: 421)
Name: NF5470_low_4
Description: NF5470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5470_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 12 - 293
Target Start/End: Original strand, 38038224 - 38038528
Alignment:
| Q |
12 |
atgaacatgaagtatgggccttgtatggggatgacgaggctggcacgcttggagcgtgctgtgaagcttggtttgaaccctccagaggaaatcgcggaac |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38038224 |
atgaacatgaagtatgggccttgtatggggatgacgaggctggcacgcttggagcgtgctgtgaagcttggtttgaaccctccggaggaaatcgcggaac |
38038323 |
T |
 |
| Q |
112 |
tcttgaagagtggtaaagttcagcaagaatcactttgggacactcgcatttagaacgctgcttaaatgtaataat--------------------cttgt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38038324 |
tcttgaagagtggtaaagttcagcaagaatcactttgggacactcgcatttagaacgctgcttaaatgtaataatcttgttgtagcttcttctgacttgt |
38038423 |
T |
 |
| Q |
192 |
ttgtttgtttaggttttgcttagggaaaatcagtttcttgctgtgtcccctttccctg---gtagtagtattatgttttcttatgtgactcgaaatcttg |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
38038424 |
ttgtttgtttaggttttgcttagggaaaatcactttcttgctgtgtcccctttccctggtagtagtagtagtatgttttcttatgtgactcgatatcttg |
38038523 |
T |
 |
| Q |
289 |
ttgtt |
293 |
Q |
| |
|
||||| |
|
|
| T |
38038524 |
ttgtt |
38038528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 333 - 402
Target Start/End: Original strand, 38038530 - 38038599
Alignment:
| Q |
333 |
tgttctgttctgttcttatgctgttaattgtgcaattgatacatgttgtttgaggaagtaaattcgaagt |
402 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
38038530 |
tgttctgttctgttcttatgctgttaattgtgcaattgatacatgctgtttgagggagtaaattcgaagt |
38038599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University