View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5471_high_2 (Length: 251)
Name: NF5471_high_2
Description: NF5471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5471_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 19 - 223
Target Start/End: Original strand, 39719014 - 39719230
Alignment:
| Q |
19 |
gttttacaataccaatcttagttgttggtccctcgtctccttttcaatgcgattgtgttttaaaatgtaacattatctatt------------tttaatt |
106 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39719014 |
gttttacaatgccaatcttagttgttggtccctcgtctccttttcaatgcgattgtgttttaaaatgtaacattatctatttgatctatttgatttaatt |
39719113 |
T |
 |
| Q |
107 |
acacttttagcccctcaatgtatagaaacaagccgacttgcaatacggtctatatattnnnnnnnnnnttgctttgacactattatgaagatatctatct |
206 |
Q |
| |
|
|||||||| || |||||||||||||||||| ||| ||||||||||||||||||||||| ||| | ||||||||||||||||||||||||| |
|
|
| T |
39719114 |
acacttttggctcctcaatgtatagaaacatgccaacttgcaatacggtctatatattaaaaaaaaaaatgcatcgacactattatgaagatatctatct |
39719213 |
T |
 |
| Q |
207 |
caaaatttacatattat |
223 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
39719214 |
taaaatttacatattat |
39719230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University