View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5472-Insertion-5 (Length: 427)
Name: NF5472-Insertion-5
Description: NF5472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5472-Insertion-5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 3e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 7 - 134
Target Start/End: Original strand, 52250227 - 52250354
Alignment:
| Q |
7 |
actagtgagctagagtttcaacggtcaagggtcaaacactatgggacacaacaaaacaacatggattggtgtttgtttgtttgttacatctacttcaaac |
106 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52250227 |
actagtgagctagagtttcaagggtcaagggtcaaacactatgggacacaacaaaacaacatggattggtgtttgtttgtttgttacatctacttcaaac |
52250326 |
T |
|
| Q |
107 |
caaacatacctcagtacttgttttgaag |
134 |
Q |
| |
|
||||||||||| |||||||||||||||| |
|
|
| T |
52250327 |
caaacataccttagtacttgttttgaag |
52250354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 202 - 427
Target Start/End: Original strand, 52250443 - 52250666
Alignment:
| Q |
202 |
tgtttcattcattcattttctgtttcaatnnnnnnn-tctatcccccac--tttgtatannnnnnnattgaactaataacatcacatcactaatgtctct |
298 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| | |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52250443 |
tgtttcattcattcattttctgtttcaataaaaaaaatctatccccccccctttgtatatttttttattgaactaataacatcacatcactaatgtctct |
52250542 |
T |
|
| Q |
299 |
tctcaaatgtgactacaacaaacaatatatcatcatcatcatcatgacataacagaaaacatnnnnnnnnncctataaaaaagtattgccaacacgacca |
398 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
52250543 |
tctcaaatgtgactacaacaaacaatat---atcatcatcatcatgacataacagaaaacat--aaaaaaacttataaaaaagtattgccaacacgacca |
52250637 |
T |
|
| Q |
399 |
cgatgcaacaaatcatgagcaatattatc |
427 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
52250638 |
cgatgcaacaaatcatgagcaatattatc |
52250666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University