View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5472_high_5 (Length: 385)
Name: NF5472_high_5
Description: NF5472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5472_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 289; Significance: 1e-162; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 75 - 375
Target Start/End: Original strand, 41314154 - 41314453
Alignment:
| Q |
75 |
aaccaacccaacactaacacacacattccttttcagacaatggtgaaactagcttcagcaagagagttccgtacatacggcccgggcctcactagaaacc |
174 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41314154 |
aaccaacccaacacta-cacacacattccttttcagacaatggtgaaactagcttcagcaagagagttccgtacatacggcccgggcctcactagaaacc |
41314252 |
T |
 |
| Q |
175 |
gttacgaatacataaacgcaggcctatatctatttgccaccgtgatcctttgttccggttttgtggcccagctttctcctgaagcccgttcgggcctcgt |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41314253 |
gttacgaatacataaacgcaggcctatatctatttgccaccgtgatcctttgttccggttttgtggcccagctttctcctgaagcccgttcgggcctcgt |
41314352 |
T |
 |
| Q |
275 |
tgttcttcttattgctcttaccattattatctttgttaatcttcatgatattcttgctcatttcgctgccattgatttccgctcgtctttgttgcccttt |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41314353 |
tgttcttcttattgctcttaccattattatctttgttaatcttcatgatattcttgctcattttgctgccattgatttccgctcgtctttgttgcccttt |
41314452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 41314078 - 41314127
Alignment:
| Q |
1 |
aagtagccacgtgtccaatccaaaatctcaactctttcctctcttcaacg |
50 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41314078 |
aagtagccacgtgtccaagccaaaatctcaactctttcctctcttcaacg |
41314127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University