View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5472_low_21 (Length: 212)
Name: NF5472_low_21
Description: NF5472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5472_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 5e-95; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 37276978 - 37277173
Alignment:
| Q |
1 |
gaactagaaagggggatcctccatcagcaaacggcatcaatattgtggcgggaccaattggaggacccgtgcctgcaggtaccttcgataatattgcacc |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
37276978 |
gaactagaaagggggatcctccttcagcaaacggcatcaatattgtggcgggaccaattggaggacccgtgcatgcaggtacctttgataatattgcacc |
37277077 |
T |
 |
| Q |
101 |
cgcacctagtgccgcctctaccatctacatctcctccatcgcaggaacagctgtaactgctgcaatcgctggcttcttctacttttgattatatat |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37277078 |
cgcacctagtgccgcctctaccatctacatctcctccatcgcaggaacagttgtaactgcttcaatcgctggcttcttctacttttgattatatat |
37277173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 41 - 196
Target Start/End: Original strand, 37261277 - 37261432
Alignment:
| Q |
41 |
tattgtggcgggaccaattggaggacccgtgcctgcaggtaccttcgataatattgcacccgcacctagtgccgcctctaccatctacatctcctccatc |
140 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||| | ||| ||||||||| || ||| |||||||||| ||||||||||||| ||||| ||||| || || |
|
|
| T |
37261277 |
tattgtggcgggacccattggtggacccgtgcctcctggtgccttcgatagtactgcgcccgcacctaatgccgcctctaccgtctacttctccaccgtc |
37261376 |
T |
 |
| Q |
141 |
gcaggaacagctgtaactgctgcaatcgctggcttcttctacttttgattatatat |
196 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37261377 |
gcaggaacggctgcaactgctgcaatcgctggcttcttctacttttgattttatat |
37261432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 41 - 196
Target Start/End: Original strand, 37265050 - 37265205
Alignment:
| Q |
41 |
tattgtggcgggaccaattggaggacccgtgcctgcaggtaccttcgataatattgcacccgcacctagtgccgcctctaccatctacatctcctccatc |
140 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||| | ||| |||||||| || ||| |||||||||| ||||||||||||| ||||| ||||| ||||| |
|
|
| T |
37265050 |
tattgtggcgggacccattggtggacccgtgcctccgggtgccttcgatggtactgcgcccgcacctaatgccgcctctaccgtctacttctccaccatc |
37265149 |
T |
 |
| Q |
141 |
gcaggaacagctgtaactgctgcaatcgctggcttcttctacttttgattatatat |
196 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37265150 |
gcaggaacggctgcaactgctgcaatcgctggcttcttctacttttgattttatat |
37265205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 41 - 196
Target Start/End: Original strand, 37280852 - 37281007
Alignment:
| Q |
41 |
tattgtggcgggaccaattggaggacccgtgcctgcaggtaccttcgataatattgcacccgcacctagtgccgcctctaccatctacatctcctccatc |
140 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||| ||||| |||| ||| || ||| ||| |||||||||||||||||| ||||||| |||| || || |
|
|
| T |
37280852 |
tattgtggcgggaccccttggtggacctgtgcctccaggtgcctttgatgctactgcgcccccacctagtgccgcctctagcatctacttctctgccgtc |
37280951 |
T |
 |
| Q |
141 |
gcaggaacagctgtaactgctgcaatcgctggcttcttctacttttgattatatat |
196 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37280952 |
gcaggaacagctgcaactgctgcagtcgctggcttcttctacttttgattatatat |
37281007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University