View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5472_low_22 (Length: 206)
Name: NF5472_low_22
Description: NF5472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5472_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 31 - 192
Target Start/End: Complemental strand, 52369646 - 52369483
Alignment:
| Q |
31 |
actaaatacataactaactagttt--caaagttaattgagtacacttattggaggctaactatgaaactttactatacgatgatgacagatatcataatt |
128 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52369646 |
actaaatacataactaactagtttttcaaagttaattgagtacacttattggaggctaactatgaaactttactatacgatgatgacagatatcataatt |
52369547 |
T |
 |
| Q |
129 |
tgttgaacaaatgaatgcaattatttggttttgaccaatataataaatattcaactactatatg |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52369546 |
tgttgaacaaatgaatgcaattatttggttttgaccaatataataaatattcaactactatatg |
52369483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University