View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5472_low_22 (Length: 206)

Name: NF5472_low_22
Description: NF5472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5472_low_22
NF5472_low_22
[»] chr4 (1 HSPs)
chr4 (31-192)||(52369483-52369646)


Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 31 - 192
Target Start/End: Complemental strand, 52369646 - 52369483
Alignment:
31 actaaatacataactaactagttt--caaagttaattgagtacacttattggaggctaactatgaaactttactatacgatgatgacagatatcataatt 128  Q
    ||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52369646 actaaatacataactaactagtttttcaaagttaattgagtacacttattggaggctaactatgaaactttactatacgatgatgacagatatcataatt 52369547  T
129 tgttgaacaaatgaatgcaattatttggttttgaccaatataataaatattcaactactatatg 192  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52369546 tgttgaacaaatgaatgcaattatttggttttgaccaatataataaatattcaactactatatg 52369483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University