View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5474_high_16 (Length: 379)
Name: NF5474_high_16
Description: NF5474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5474_high_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 2e-65; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 18 - 265
Target Start/End: Complemental strand, 29728829 - 29728578
Alignment:
| Q |
18 |
gtactggtagtgcgaaattgacgagagctacaccggagttttcgagtgaggcac-gcgtgtacgattagaaatcgagggttttgaaattaactcatcatt |
116 |
Q |
| |
|
|||||||| ||||||||| |||||||||||| ||| ||||| ||||| | ||| ||| |||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
29728829 |
gtactggttgtgcgaaatcgacgagagctacgccgacgttttagagtgtgacaccgcgcttacgattacaaattgagggttttgaaattaactcatcatt |
29728730 |
T |
|
| Q |
117 |
ttgggacttctgcttcaatttcgatctgttttctaatcaggtaattacannnnnnnncctgattctgtaaatattgcacaaatcattctccaaatttgtt |
216 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||| |||||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29728729 |
ttgggacttctgcttcaatttcgatttgtcttctaatcagttaattaca-tttttttcctgatcttgtaaatattgcacaaatcattctccaaatttgtt |
29728631 |
T |
|
| Q |
217 |
ga----atttatattttattgtaatctcacaaagcaaatgaaagaatcatatg |
265 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29728630 |
gatttgatttatattttattgtaatctcacaaagcaaatggaagaatcatatg |
29728578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 270 - 330
Target Start/End: Complemental strand, 29727339 - 29727279
Alignment:
| Q |
270 |
ttctttagaatagaagctttatgctattttgggcaacaatcattcaacctgaacctcttaa |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29727339 |
ttctttagaatagaagctttatgctattttgggcaacaatcattcaacctgaacctcttaa |
29727279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University