View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5474_high_17 (Length: 378)
Name: NF5474_high_17
Description: NF5474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5474_high_17 |
 |  |
|
| [»] scaffold0565 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0565 (Bit Score: 343; Significance: 0; HSPs: 1)
Name: scaffold0565
Description:
Target: scaffold0565; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 20 - 366
Target Start/End: Original strand, 5205 - 5551
Alignment:
| Q |
20 |
aaatagcaaggaacttgttgtgcaactccaattccactccacaaactcaaaaccaacactactatccctatattcatcatagagaggtccaaaaatgcca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5205 |
aaatagcaaggaacttgttgtgcaactccaattccactccacaaactcaaaaccaacactactatccctatattcatcatagagaggtccaaaaatgcca |
5304 |
T |
 |
| Q |
120 |
ttgaaaaatgaggtaaataattgtaatggctaatggggtgtgtgtggaaagagagagggaattggatgatgaaaatgtgaaatgagcaaagctatatatg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5305 |
ttgaaaaatgaggtaaataattgtaatggctaatggggtgtgtgtggaaagagagagggaattggatgatgaaaatgtgaaatgagcaaagctatatatg |
5404 |
T |
 |
| Q |
220 |
tagtggtggatgaggcaaagatttctaaaggcttttacgtatggttgaggatattttggtagaagctagcattaaatttacgcggatataatgtgaaact |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5405 |
tagtggtggatgaggcaaagatttctaaaggcttttacgtacggttgaggatattttggtagaagctagcattaaatttacgcggatataatgtgaaact |
5504 |
T |
 |
| Q |
320 |
gaatgaaaatgctggcatgagatttagttctgcgtgcatgatcagat |
366 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5505 |
gaatgaaaatgctggcatgagatttagttctgcgtgcatgatcagat |
5551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University