View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5474_high_23 (Length: 353)

Name: NF5474_high_23
Description: NF5474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5474_high_23
NF5474_high_23
[»] chr6 (2 HSPs)
chr6 (65-336)||(12245787-12246067)
chr6 (1-62)||(12245690-12245751)


Alignment Details
Target: chr6 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 65 - 336
Target Start/End: Original strand, 12245787 - 12246067
Alignment:
65 agattgagtggcatccgtttgtatgtaattttactggcagcaatgttgacaccgacatctggtctttgaaggattttggag---------gatgaggacc 155  Q
    |||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||         ||||||||||    
12245787 agattgagtggcattcgtttgtatgtaattttactggcagcaacgttgacaccgacatctggtctttgaaggattttggaggataaggaggatgaggacc 12245886  T
156 catatttacctgtgttggttgtacaaggatcaaatttgaaggaatatgaagcatctcatcttttttgtttgcaaaaggaggcatggatatcacaaacaat 255  Q
    ||||||||||||||||||||||||||||||||||||| ||||| ||||||||| ||||||||||||||||| |||||| |||||||||||||||||||||    
12245887 catatttacctgtgttggttgtacaaggatcaaatttaaaggagtatgaagcaactcatcttttttgtttgtaaaaggtggcatggatatcacaaacaat 12245986  T
256 gacgaataatcagactattggtaaaattgcggaaattaaaattgtgatggtaatgatactgtttctagggagagggttatg 336  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
12245987 gacggataatcagactattggtaaaattgcggaaattaaaattgtgatggtaatgatactgttgctagggagagggttatg 12246067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 12245690 - 12245751
Alignment:
1 gatcggaggtaaattaaattattagacttttggaacgatgaacctccactatgttttggcaa 62  Q
    ||||||||||||||||||||||| ||||||||||||||||||| | | || |||||||||||    
12245690 gatcggaggtaaattaaattatttgacttttggaacgatgaacgttctctgtgttttggcaa 12245751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University