View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5474_low_23 (Length: 353)
Name: NF5474_low_23
Description: NF5474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5474_low_23 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 65 - 336
Target Start/End: Original strand, 12245787 - 12246067
Alignment:
| Q |
65 |
agattgagtggcatccgtttgtatgtaattttactggcagcaatgttgacaccgacatctggtctttgaaggattttggag---------gatgaggacc |
155 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
12245787 |
agattgagtggcattcgtttgtatgtaattttactggcagcaacgttgacaccgacatctggtctttgaaggattttggaggataaggaggatgaggacc |
12245886 |
T |
|
| Q |
156 |
catatttacctgtgttggttgtacaaggatcaaatttgaaggaatatgaagcatctcatcttttttgtttgcaaaaggaggcatggatatcacaaacaat |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| ||||||||| ||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
12245887 |
catatttacctgtgttggttgtacaaggatcaaatttaaaggagtatgaagcaactcatcttttttgtttgtaaaaggtggcatggatatcacaaacaat |
12245986 |
T |
|
| Q |
256 |
gacgaataatcagactattggtaaaattgcggaaattaaaattgtgatggtaatgatactgtttctagggagagggttatg |
336 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
12245987 |
gacggataatcagactattggtaaaattgcggaaattaaaattgtgatggtaatgatactgttgctagggagagggttatg |
12246067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 12245690 - 12245751
Alignment:
| Q |
1 |
gatcggaggtaaattaaattattagacttttggaacgatgaacctccactatgttttggcaa |
62 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| | | || ||||||||||| |
|
|
| T |
12245690 |
gatcggaggtaaattaaattatttgacttttggaacgatgaacgttctctgtgttttggcaa |
12245751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University