View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5474_low_29 (Length: 251)

Name: NF5474_low_29
Description: NF5474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5474_low_29
NF5474_low_29
[»] chr5 (1 HSPs)
chr5 (19-201)||(5740060-5740242)


Alignment Details
Target: chr5 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 19 - 201
Target Start/End: Complemental strand, 5740242 - 5740060
Alignment:
19 aatatggctaaagataataagcaacaacaattaaatacaaaatactttatgaattatgagataacattatttaccaaaacataacataagcattaaaaca 118  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5740242 aatatggctaaagataataagcaacaacaattaaatacaaaatgctttatgaattatgagataacattatttaccaaaacataacataagcattaaaaca 5740143  T
119 tgcatacaaaccttttgaagtttaataaaacgagacccatccatggttaacttaatcctaaaagttgatcgcaaaaactaatt 201  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5740142 tgcatacaaaccttttgaagtttaataaaacgagacccatccatggttaacttaatcctaaaagttgatcgcaaaaactaatt 5740060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University