View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5477-Insertion-10 (Length: 247)
Name: NF5477-Insertion-10
Description: NF5477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5477-Insertion-10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 4e-50; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 8 - 119
Target Start/End: Complemental strand, 7837417 - 7837305
Alignment:
| Q |
8 |
caagttacctcatagctctatgatattgaaaaagccctttcaggtttacgcattaccttccattttctc-ttttattttaacatgaggtaatattgtcag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7837417 |
caagttacctcatagctctatgatattgaaaaagccctttcaggtttacgcattactttccattttctctttttattttaacatgaggtaatattgtcag |
7837318 |
T |
|
| Q |
107 |
tataactagaaag |
119 |
Q |
| |
|
||||||||||||| |
|
|
| T |
7837317 |
tataactagaaag |
7837305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 182 - 247
Target Start/End: Complemental strand, 7837242 - 7837177
Alignment:
| Q |
182 |
gaggacttaacattcatcaatctctcctatagtcaatccataactcaaattcctaatttgtctgga |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7837242 |
gaggacttaacattcatcaatctctcctatagtcaatccataactcaaattcctaatttgtctgga |
7837177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 182 - 247
Target Start/End: Complemental strand, 7760809 - 7760744
Alignment:
| Q |
182 |
gaggacttaacattcatcaatctctcctatagtcaatccataactcaaattcctaatttgtctgga |
247 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7760809 |
gaggacttgacattcatcaatctctcccatagtcaatccataactcaaattcctaatctgtctgga |
7760744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 182 - 247
Target Start/End: Complemental strand, 7753739 - 7753674
Alignment:
| Q |
182 |
gaggacttaacattcatcaatctctcctatagtcaatccataactcaaattcctaatttgtctgga |
247 |
Q |
| |
|
||||| ||||| |||||||||||||| |||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
7753739 |
gaggatttaacgctcatcaatctctcccatagtcaatccataactcaagttcctgatttgtctgga |
7753674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 7753869 - 7753825
Alignment:
| Q |
8 |
caagttacctcatagctctatgatattgaaaaagccctttcaggt |
52 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7753869 |
caagttacctcatagttctatgatattgaaaaagccctttcaggt |
7753825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University