View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5477-Insertion-2 (Length: 843)
Name: NF5477-Insertion-2
Description: NF5477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5477-Insertion-2 |
 |  |
|
| [»] scaffold0287 (1 HSPs) |
 |  |  |
|
| [»] scaffold0402 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |  |
|
| [»] scaffold0595 (1 HSPs) |
 |  |  |
|
| [»] scaffold0013 (1 HSPs) |
 |  |  |
|
| [»] scaffold0515 (1 HSPs) |
 |  |  |
|
| [»] scaffold0432 (1 HSPs) |
 |  |  |
|
| [»] scaffold0306 (1 HSPs) |
 |  |  |
|
| [»] scaffold0778 (1 HSPs) |
 |  |  |
|
| [»] scaffold0457 (1 HSPs) |
 |  |  |
|
| [»] scaffold0061 (1 HSPs) |
 |  |  |
|
| [»] scaffold0244 (1 HSPs) |
 |  |  |
|
| [»] scaffold0882 (1 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold0057 (1 HSPs) |
 |  |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |  |
|
| [»] scaffold0122 (2 HSPs) |
 |  |  |
|
| [»] scaffold0364 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
| [»] scaffold0633 (1 HSPs) |
 |  |  |
|
| [»] scaffold0041 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (2 HSPs) |
 |  |  |
|
| [»] scaffold0163 (2 HSPs) |
 |  |  |
|
| [»] scaffold0795 (1 HSPs) |
 |  |  |
|
| [»] scaffold0070 (1 HSPs) |
 |  |  |
|
| [»] scaffold0242 (2 HSPs) |
 |  |  |
|
| [»] scaffold0502 (1 HSPs) |
 |  |  |
|
| [»] scaffold0548 (2 HSPs) |
 |  |  |
|
| [»] scaffold0530 (1 HSPs) |
 |  |  |
|
| [»] scaffold0223 (1 HSPs) |
 |  |  |
|
| [»] scaffold0204 (1 HSPs) |
 |  |  |
|
| [»] scaffold0131 (1 HSPs) |
 |  |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
| [»] scaffold0160 (1 HSPs) |
 |  |  |
|
| [»] scaffold0098 (1 HSPs) |
 |  |  |
|
| [»] scaffold0684 (1 HSPs) |
 |  |  |
|
| [»] scaffold0027 (1 HSPs) |
 |  |  |
|
| [»] scaffold0669 (1 HSPs) |
 |  |  |
|
| [»] scaffold1348 (1 HSPs) |
 |  |  |
|
| [»] scaffold0086 (1 HSPs) |
 |  |  |
|
| [»] scaffold0038 (1 HSPs) |
 |  |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 9e-60; HSPs: 152)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 9e-60
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 48612516 - 48612646
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48612516 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
48612613 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
48612614 |
tttataatggctttgccatttcgtctatctacc |
48612646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 112; E-Value: 4e-56
Query Start/End: Original strand, 516 - 654
Target Start/End: Complemental strand, 3497652 - 3497516
Alignment:
| Q |
516 |
tatagtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtg |
615 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |||| |
|
|
| T |
3497652 |
tatagtatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccctggtacctccacttgtgtg |
3497555 |
T |
 |
| Q |
616 |
tgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3497554 |
tgtgagtttataatggctttgccatttcgtctatctacc |
3497516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 112; E-Value: 4e-56
Query Start/End: Original strand, 521 - 652
Target Start/End: Complemental strand, 40656240 - 40656109
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
40656240 |
tatctagaagtcctagctcaactggcaaaaaatgccgatattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
40656141 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
40656140 |
gtttataatggctttgccatttcgtctatcta |
40656109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 111; E-Value: 1e-55
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 35157214 - 35157083
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35157214 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttatgtgtgtga |
35157117 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
35157116 |
gtttataatggctttgccatttcgtctatctacc |
35157083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 106; E-Value: 1e-52
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 31717296 - 31717426
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| |||| |||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
31717296 |
atccagaagtcctagctcaactggtaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaactccggtacctccacttatgtgtgtgag |
31717393 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
31717394 |
tttataatggctttgccatttcgtctatctacc |
31717426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 105; E-Value: 5e-52
Query Start/End: Original strand, 521 - 653
Target Start/End: Original strand, 40013261 - 40013392
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||| ||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
40013261 |
tatccagaagtcctagctcaactgacaaaa-atgccgaaattgttaggccggatgccatgaccgaggttcgaaccccggtacctccacttgtgtgtgtga |
40013359 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
40013360 |
gtttataatggctttgccatttcgtctatctac |
40013392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 103; E-Value: 8e-51
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 4106552 - 4106683
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| |||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
4106552 |
tatccagaagtcctagctcaactggtaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
4106649 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
4106650 |
gtttataatggctttgccatttcatctatctacc |
4106683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 103; E-Value: 8e-51
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 35849293 - 35849424
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
35849293 |
tatccagaagtcctagctcaactggcaaag--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctctacttgtgtgtgtga |
35849390 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
35849391 |
gtttataatggctttgccatttcgtctatctacc |
35849424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 101; E-Value: 1e-49
Query Start/End: Original strand, 526 - 654
Target Start/End: Original strand, 1869818 - 1869945
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||| ||||||||||||||||||||||||||||||||||| ||||||||| ||||| |||||||||||||| |
|
|
| T |
1869818 |
agaagtcctagctcaactggcaaaa-atgccgatattgttaggccggatgccatgaccggggttcgaactccggtacctccacttgtgtgtgtgagttta |
1869916 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1869917 |
taatggctttgccatttcgtctatctacc |
1869945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 100; E-Value: 5e-49
Query Start/End: Original strand, 522 - 652
Target Start/End: Complemental strand, 10061145 - 10061017
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| ||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |||||||||| |
|
|
| T |
10061145 |
atccacaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaatcccggtacctccacttgtgtgtgtgag |
10061048 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
10061047 |
tttataatggctttgccatttcgtctatcta |
10061017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 100; E-Value: 5e-49
Query Start/End: Original strand, 520 - 654
Target Start/End: Original strand, 45236927 - 45237059
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| ||||| ||||| ||| |||| |
|
|
| T |
45236927 |
gtatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgaccggggttcgaaccccgatacctccacttgtgtatgtg |
45237024 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
45237025 |
agtttataatggctttgccatttcgtctatctacc |
45237059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 99; E-Value: 2e-48
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 4069246 - 4069115
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||||||||| |||| ||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
4069246 |
tatccagaagtcctaactcaactggcaaaata--ccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
4069149 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
4069148 |
gtttataatggctttgccatttcgcctatctacc |
4069115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 99; E-Value: 2e-48
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 17895632 - 17895763
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||| |||||||||||||| ||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
17895632 |
tatcctgaagtcctagctcaactggcaaaa--tgctgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
17895729 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
17895730 |
gtttataatggctttgtcatttcgtctatctacc |
17895763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 97; E-Value: 3e-47
Query Start/End: Original strand, 523 - 654
Target Start/End: Complemental strand, 27396442 - 27396313
Alignment:
| Q |
523 |
tccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagt |
622 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
27396442 |
tccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgattggggttcgaaccccggtacctccacttgtgtgtgtgagt |
27396345 |
T |
 |
| Q |
623 |
ttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |
|
|
| T |
27396344 |
ttataatggttttgccatttcgtctatctacc |
27396313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 1573971 - 1573840
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| |||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| | |
|
|
| T |
1573971 |
tatccagaagtcctagctcaactggtaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtaa |
1573874 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||| |
|
|
| T |
1573873 |
gtttataatggctttaccattttgtctatctacc |
1573840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 4887643 - 4887512
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| ||||||||||| | ||| | ||||| ||||||||| |
|
|
| T |
4887643 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccgaggttcgaaccctgatacatccacttgtgtgtgtga |
4887546 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
4887545 |
gtttataatggctttgccatttcgtctatctacc |
4887512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 18944922 - 18945053
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| |||||||||||||||||||||| |||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
18944922 |
tatccagaagtcctagttcaactggcaaaa--tgccgaaattgttaggccggatatcatgaccggggttcgaaccctggtacctccacttatgtgtgtga |
18945019 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
18945020 |
gtttataatggctttgccatttcatctatctacc |
18945053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 548 - 654
Target Start/End: Original strand, 19258447 - 19258553
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
19258447 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtct |
19258546 |
T |
 |
| Q |
648 |
atctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
19258547 |
ttctacc |
19258553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 29151581 - 29151712
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||| |||||||||||||||||||| |||| |||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
29151581 |
tatccagaagtcctagctcaactggcaaaa--tgctgaaattgttaggccggatgctatgatcggggttcgaaccccggtacctccacttgtgtgtgtga |
29151678 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
29151679 |
gtttataatggctttaccatttcgtctatctacc |
29151712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 34708671 - 34708801
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||| ||||||||||||||| ||||||||| ||||||| |||||||||| |||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
34708671 |
tatctagaagtcctagctcaactggcaaaa-atgccgatattgttaggctggatgccatgaccggggttcgaaccccggtacctccactta--tgtgtga |
34708767 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
34708768 |
gtttataatggctttgccatttcgtctatctacc |
34708801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 5508709 - 5508814
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5508709 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttgtaatggctttgccatttcgtcta |
5508808 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
5508809 |
tctacc |
5508814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 547 - 652
Target Start/End: Original strand, 8946450 - 8946555
Alignment:
| Q |
547 |
aaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8946450 |
aaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgcgtgtgtgagtttataatggctttgccatttcgtc |
8946549 |
T |
 |
| Q |
647 |
tatcta |
652 |
Q |
| |
|
|||||| |
|
|
| T |
8946550 |
tatcta |
8946555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 16816715 - 16816820
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16816715 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccgcggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtcta |
16816814 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
16816815 |
tctacc |
16816820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 45041862 - 45041732
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||| ||||||| ||||||||| |||||||||||||||| |||||||| |||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
45041862 |
atccagaagtcttagctcaactggcaaaa--tgccgaaattgttaggtcggatgccttgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
45041765 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
45041764 |
tttataatgactttgccatttcgtctatctacc |
45041732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 520 - 648
Target Start/End: Complemental strand, 47584802 - 47584676
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
||||||||||||||||||||| ||||||||| || ||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
47584802 |
gtatccagaagtcctagctcaactggcaaaa--tgtcgacattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtg |
47584705 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||| ||||| |||||||||| |
|
|
| T |
47584704 |
agtttataatggttttgcaatttcgtcta |
47584676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 92; E-Value: 3e-44
Query Start/End: Original strand, 528 - 654
Target Start/End: Original strand, 21226070 - 21226194
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttata |
627 |
Q |
| |
|
|||||||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
21226070 |
aagtcctatctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttata |
21226167 |
T |
 |
| Q |
628 |
atggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||| |||||||||||| |||||||||| |
|
|
| T |
21226168 |
atgtctttgccatttcatctatctacc |
21226194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 1323682 - 1323812
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||| ||||||||||||||| ||||||| |||||||||||| ||||||| ||||| |||||||||| |
|
|
| T |
1323682 |
atccagaagtcctagctcaactggcaaaa--tgccgaatttgttaggccggatgtcatgaccagggttcgaacccaggtacctccacttgtgtgtgtgag |
1323779 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
1323780 |
tttataatgactttgccatttcgtctatctacc |
1323812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 2354927 - 2354794
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcact--tatgtgtgt |
618 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||||||||| ||||||||| |||||||||||| ||||| |||| | ||||||| |
|
|
| T |
2354927 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgaccggagttcgaaccccgatacctccacttgtgtgtgtgt |
2354830 |
T |
 |
| Q |
619 |
gagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
2354829 |
gagtttataatggctttgccatttcgtctatctacc |
2354794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 3861465 - 3861335
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||| | | ||||||||| || |||||||||||||||||||| ||||| |||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
3861465 |
atccagaagtcctagtttaactggcaaaa--tgtcgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgtgag |
3861368 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
3861367 |
tttataatggctttgccatttcgtctatctacc |
3861335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 522 - 653
Target Start/End: Original strand, 19306711 - 19306841
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| ||| ||||| |||||||||| |
|
|
| T |
19306711 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattattaggccggatgccatgaccggggttcgaaccccggttcctccacttgtgtgtgtgag |
19306808 |
T |
 |
| Q |
622 |
tttataatggctttgcca-tttcgtctatctac |
653 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||| |
|
|
| T |
19306809 |
tttataatagctttgccattttcgtctatctac |
19306841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 526 - 654
Target Start/End: Complemental strand, 23789539 - 23789414
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||||| ||| |||||||||| |||||| ||||||||||||||||||||||||||||||||||||| ||||||| |||| |||||||||||||| |
|
|
| T |
23789539 |
agaagtcctagttcaactggcaaaaa-tgccgatattgttaggccggatgccatgaccggggttcgaaccctggtacctccact--tgtgtgtgagttta |
23789443 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23789442 |
taatggctttgccatttcgtctatctacc |
23789414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 522 - 653
Target Start/End: Original strand, 40809044 - 40809173
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||| ||||||||||||||| ||||||| |||||||||||| ||||||| ||||| |||||||||| |
|
|
| T |
40809044 |
atccagaagtcctagctcaactggcaaaa--tgccgaatttgttaggccggatgtcatgaccagggttcgaaccctggtacctccacttgtgtgtgtgag |
40809141 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |
|
|
| T |
40809142 |
tttataatgactttgccatttcgtctatctac |
40809173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 520 - 652
Target Start/End: Complemental strand, 47086432 - 47086301
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
||||||| ||||||||||||| ||| |||||| || |||||||||||||||||||||||||| |||||||||||||| | ||||| |||||||||||||| |
|
|
| T |
47086432 |
gtatccataagtcctagctcaactgacaaaaa-tgtcgaaattgttaggccggatgccatgatcggggttcgaaccctgttacctccacttatgtgtgtg |
47086334 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
47086333 |
agtttataatggctttaccatttcgtctatcta |
47086301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 525 - 654
Target Start/End: Complemental strand, 4674435 - 4674308
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||| | | ||| |||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
4674435 |
cagaagtcctagctcaactggcaaaa--tgccgaaattgttaagtcagatatcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
4674338 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4674337 |
ataatggctttgccatttcgtctatctacc |
4674308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 525 - 654
Target Start/End: Complemental strand, 7312579 - 7312452
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| ||||||||| |||| |||||||||||||||||| |||||||||||||||||||||||||||| ||||| ||||||||| ||| |
|
|
| T |
7312579 |
cagaagtcctagctcaactggcaaaa--tgccaaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgaattt |
7312482 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||| |||||| |||||||||||||||||| |
|
|
| T |
7312481 |
ataacggctttaccatttcgtctatctacc |
7312452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 6327210 - 6327340
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
|||||||||||||| |||| ||| ||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||| |
|
|
| T |
6327210 |
atccagaagtcctaactcaactgacaaaa--tgcaaaaattgttaggccggatgccatgaccggggttcgaaccccggtacatccacttgtgtgtgtgag |
6327307 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
6327308 |
tttataatgactttgccatttcgtctatctacc |
6327340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 521 - 652
Target Start/End: Original strand, 9379989 - 9380116
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| || |||||||||||||||||||| ||||||||||||||||||||| |||||| |||| ||||||||| |
|
|
| T |
9379989 |
tatccagaagtcctagctcaactggcaaaa--tgtcgaaattgttaggccggatgtcatgaccggggttcgaaccccagtacctccact--tgtgtgtga |
9380084 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9380085 |
atttataatggctttgccatttcgtctatcta |
9380116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 48729813 - 48729683
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||||||||| ||||| || |||||||| ||||||||| ||||| |||||||||| |
|
|
| T |
48729813 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgatcgtggttcgaattccggtacctccacttgtgtgtgtgag |
48729716 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
48729715 |
tttataatggctttgccatttcgtctgtctacc |
48729683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 85; E-Value: 5e-40
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 33228698 - 33228829
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| |||||||||| || ||||||||||||||||||||||||||||| ||||||||||||||||| | ||||| |||| ||||| |
|
|
| T |
33228698 |
atccagaagtcctagctcaactggcaaaaa-tgtcgaaattgttaggccggatgccatgaccgaggttcgaaccccggtacatccacttgtgtgcgtgag |
33228796 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||| ||||| ||||| ||||||||||||||||| |
|
|
| T |
33228797 |
tttgtaatgcctttgacatttcgtctatctacc |
33228829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 4227358 - 4227461
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||| |||||||||||||| |||||||||||| |||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4227358 |
aaaataccgaaattgttaggtcggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtcta |
4227457 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
4227458 |
tcta |
4227461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 523 - 654
Target Start/End: Complemental strand, 9234377 - 9234246
Alignment:
| Q |
523 |
tccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagt |
622 |
Q |
| |
|
|||| ||||||||||||| |||| ||||||||||||||||||||||||||| || |||||||| ||||||| ||||||| || ||||| ||||||||||| |
|
|
| T |
9234377 |
tccacaagtcctagctcaactggaaaaaaatgccgaaattgttaggccggacgctatgaccggagttcgaatcccggtatctccacttgtgtgtgtgagt |
9234278 |
T |
 |
| Q |
623 |
ttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |
|
|
| T |
9234277 |
ttataatggctttatcatttcgtctatctacc |
9234246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 528 - 654
Target Start/End: Original strand, 33512802 - 33512926
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttata |
627 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||||| || | ||||||| |||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
33512802 |
aagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgctataatcggggtttgaaccccggtacctccacttgtgtgtgtgagtttata |
33512899 |
T |
 |
| Q |
628 |
atggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| ||||||||||||||||| |
|
|
| T |
33512900 |
atggctttgtcatttcgtctatctacc |
33512926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 522 - 652
Target Start/End: Complemental strand, 42557631 - 42557503
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| ||||||||||||| |||||||| ||||||||||||||||||||||||||||| ||||||| |||| ||||||||| |||||||||||||||| |
|
|
| T |
42557631 |
atccataagtcctagctcaattggcaaaa--tgccgaaattgttaggccggatgccatgatcggggtttgaactccggtacctccacttatgtgtgtgag |
42557534 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||| |||||||||||||||||||| |
|
|
| T |
42557533 |
tttataatgattttgccatttcgtctatcta |
42557503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 2228209 - 2228079
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||| ||||||| ||||||||| || |||||||||||||||||||| ||||||||||||||||| |||||||||| ||||| | |||||||| |
|
|
| T |
2228209 |
atccagaagtcgtagctcaactggcaaaa--tgtcgaaattgttaggccggatgtcatgaccggggttcgaatcccggtacctccacttgtatgtgtgag |
2228112 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||| |
|
|
| T |
2228111 |
tttataatgactttgtcatttcgtctatctacc |
2228079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 528 - 653
Target Start/End: Complemental strand, 43133227 - 43133103
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttata |
627 |
Q |
| |
|
||||||||||||| ||||||||| | ||||||||||||||| | ||| |||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
43133227 |
aagtcctagctcaaatggcaaaaa-taccgaaattgttaggctgaatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttata |
43133129 |
T |
 |
| Q |
628 |
atggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||||||||| |||||||| |
|
|
| T |
43133128 |
atggctttgccatttcgcctatctac |
43133103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 523 - 650
Target Start/End: Complemental strand, 6384646 - 6384522
Alignment:
| Q |
523 |
tccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagt |
622 |
Q |
| |
|
|||||||||||||||||| |||| |||| | ||||||||||||||||||| |||||||| ||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
6384646 |
tccagaagtcctagctcaactggtaaaata--ccgaaattgttaggccggacgccatgac-ggggttcgaaccccggtgcctccacttatgtgtgtgagt |
6384550 |
T |
 |
| Q |
623 |
ttataatggctttgccatttcgtctatc |
650 |
Q |
| |
|
|||||||| ||||||||||||||||||| |
|
|
| T |
6384549 |
ttataatgactttgccatttcgtctatc |
6384522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 6596540 - 6596669
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||| |||||||||||||||||||||||||||||||||||| || ||||||||||||| ||||||| |
|
|
| T |
6596540 |
tatccagaagtcctagctcaactggcaaaa--tgccaaaattgttaggccggatgccatgaccggggttcgaattccagtaccttcactta--tgtgtga |
6596635 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |
|
|
| T |
6596636 |
atttataatggctttgccatttcaactatctacc |
6596669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 548 - 652
Target Start/End: Original strand, 46274971 - 46275077
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgt--gtgagtttataatggctttgccatttcgt |
645 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| ||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
46274971 |
aaaaatgccgaaattgttaggtcggatgccatgaccggggttcgaatcccggtacctccacttgtgtgtgcgtgagtttataatggctttgccatttcgt |
46275070 |
T |
 |
| Q |
646 |
ctatcta |
652 |
Q |
| |
|
||||||| |
|
|
| T |
46275071 |
ctatcta |
46275077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 549 - 654
Target Start/End: Complemental strand, 1582720 - 1582617
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1582720 |
aaaatgccgaaattgttaggccggatgctatgaccggggttcgaaccccggtacctctact--tgtgtgtgagtttataatagctttgccatttcgtcta |
1582623 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
1582622 |
tctacc |
1582617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 525 - 654
Target Start/End: Complemental strand, 12014858 - 12014731
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
||||||||||| |||| |||| |||| | |||||||||||||||| || ||| |||||||||||||||||||||| ||| ||||| ||||||||||||| |
|
|
| T |
12014858 |
cagaagtcctaactcaactggtaaaata--ccgaaattgttaggccagacgccttgaccggggttcgaaccccggtgcctccacttgtgtgtgtgagttt |
12014761 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12014760 |
ataatggctttgccatttcgtctatctacc |
12014731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 78; E-Value: 7e-36
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 2286222 - 2286092
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| ||||||||||||| ||| ||||| |||| |||||||||||||||||||||||||| | |||||||||||| ||||| |||||||||||||||| |
|
|
| T |
2286222 |
atccaaaagtcctagctcaactgacaaaa--tgccaaaattgttaggccggatgccatgaccagagttcgaaccccgctacctccacttatgtgtgtgag |
2286125 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| ||||| |||| |||||||||||| |
|
|
| T |
2286124 |
tttataatgactttgtcattccgtctatctacc |
2286092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 78; E-Value: 7e-36
Query Start/End: Original strand, 521 - 653
Target Start/End: Complemental strand, 29628514 - 29628384
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||| ||||||||||||||| |||| ||||||||||||||| ||||| |||||||||||| | ||||||||| |||||||||| ||||| ||||||||| |
|
|
| T |
29628514 |
tatctagaagtcctagctcaactgg--aaaaatgccgaaattattaggtcggatgccatgatcagggttcgaatcccggtacctccacttgtgtgtgtga |
29628417 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||| |||||||||| |||||||||||||||| |
|
|
| T |
29628416 |
gtttaaaatggctttgtcatttcgtctatctac |
29628384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 78; E-Value: 7e-36
Query Start/End: Original strand, 526 - 654
Target Start/End: Original strand, 37919972 - 37920098
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||||||||| ||||||||| || ||||||||||||| | |||||||||||| || ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37919972 |
agaagtcctagctcaactggcaaaatat--cgaaattgttaggtcagatgccatgacctggattcgaaccccggtacctccacttatgtgtgtgagttta |
37920069 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||| |||||||||||||||| |
|
|
| T |
37920070 |
taatggctttattatttcgtctatctacc |
37920098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 78; E-Value: 7e-36
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 43723311 - 43723441
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| |||||||||||| ||||||||| |||| ||||||||| |||||||| ||||| ||||||||||||||||| ||| ||||| |||||||||| |
|
|
| T |
43723311 |
atccacaagtcctagctcgactggcaaaa--tgccaaaattgttaagccggatgtcatgattggggttcgaaccccggttcctccacttgtgtgtgtgag |
43723408 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43723409 |
tttataatggctttgccatttcgtctatctacc |
43723441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 78; E-Value: 7e-36
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 46416548 - 46416678
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||| ||| ||||||||| |||||| ||||||||||||||||||||||||| ||||||| ||| ||||| |||||||||||||||| |
|
|
| T |
46416548 |
atccagaagtcctaggtcaactggcaaaa--tgccgacattgttaggccggatgccatgaccgaaattcgaactccgatacctccacttatgtgtgtgag |
46416645 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||| | |||||||||||||||| |
|
|
| T |
46416646 |
tttataatggctttacaatttcgtctatctacc |
46416678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 31300126 - 31299994
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtg--tgtg |
619 |
Q |
| |
|
||||||||||||||||| | ||||||||| |||||||||||||| |||||||| ||||||||||||||||||| |||||||| |||||||||| |||| |
|
|
| T |
31300126 |
atccagaagtcctagctaaactggcaaaa--tgccgaaattgttaagccggatgtcatgaccggggttcgaacctcggtacctccacttatgtgtgtgtg |
31300029 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||| |
|
|
| T |
31300028 |
agtttataataactttgtcatttcgtctatctacc |
31299994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 522 - 653
Target Start/End: Original strand, 33628027 - 33628156
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||| |||| |||||||||||||| |||||||||||||||| |||||||||||| ||||||| ||||| |||||||||| |
|
|
| T |
33628027 |
atccagaagtcctagctcaactgacaaag--tgccgaaattgttaagccggatgccatgaccagggttcgaaccctggtacctccacttgtgtgtgtgag |
33628124 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||| |||| |||||| ||||||||| |
|
|
| T |
33628125 |
tttataatggttttgtcatttcatctatctac |
33628156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 525 - 652
Target Start/End: Original strand, 38261003 - 38261128
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| ||| ||||| || ||||||||||||||||||||||||||||| ||||| |||| | ||||||||||||||||||||||||| |
|
|
| T |
38261003 |
cagaagtcctagctcaactgacaaaa--tgtcgaaattgttaggccggatgccatgaccgaggttctaacctggataccttcacttatgtgtgtgagttt |
38261100 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||| ||||| ||||||||||||||| |
|
|
| T |
38261101 |
ataatgactttgtcatttcgtctatcta |
38261128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 526 - 652
Target Start/End: Original strand, 10166873 - 10166996
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||||||||| ||| | |||||||||||||||||||||||||||||||||||||| ||||||| | ||||||| ||||| ||| |||||||||| |
|
|
| T |
10166873 |
agaagtcctagctcaactg--ataaaatgccgaaattgttaggccggatgccatgaccggg-ttcgaactctggtacctccacttgtgtatgtgagttta |
10166969 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||| ||||||||||||||| |
|
|
| T |
10166970 |
taatggctttgtcatttcgtctatcta |
10166996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 522 - 648
Target Start/End: Original strand, 10422477 - 10422601
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||| ||||||| ||||||||| || ||||||||||||| |||||||||||| ||||||||||| |||||||||| ||||| |||||||||| |
|
|
| T |
10422477 |
atccagaagtcttagctcaactggcaaaatat--cgaaattgttaggtcggatgccatgatcggggttcgaatcccggtacctccacttgtgtgtgtgag |
10422574 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||| ||||||| |||||||||| |
|
|
| T |
10422575 |
tttataattgctttgctatttcgtcta |
10422601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 548 - 654
Target Start/End: Complemental strand, 46734221 - 46734115
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||| |||||||||||||| ||||| ||||| |||||||||||||||| ||||| ||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46734221 |
aaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccgttacctccacttgtgtgtgtgagtttataatggctttgccattccgtct |
46734122 |
T |
 |
| Q |
648 |
atctacc |
654 |
Q |
| |
|
||||||| |
|
|
| T |
46734121 |
atctacc |
46734115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 26794910 - 26795043
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcact--tatgtgtgt |
618 |
Q |
| |
|
|||||| ||||||||||||| | ||||||| |||| |||||||||| ||||||||||||||||||||||||| ||||||||| |||| ||||||||| |
|
|
| T |
26794910 |
tatccacaagtcctagctcaaccggcaaaa--tgccaaaattgttagatcggatgccatgaccggggttcgaactccggtacctccacttatatgtgtgt |
26795007 |
T |
 |
| Q |
619 |
gagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
26795008 |
gagtttataatggttttgccatttcgtctaactacc |
26795043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 73; E-Value: 7e-33
Query Start/End: Original strand, 519 - 654
Target Start/End: Complemental strand, 37410834 - 37410701
Alignment:
| Q |
519 |
agtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgt |
618 |
Q |
| |
|
|||||| ||||||| ||||||| ||||||||| ||||||||||||||||||||||| |||||| ||||||||||||| | ||||| ||||| ||||||| |
|
|
| T |
37410834 |
agtatctagaagtcttagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgactggggttcgaaccctgatacctccacttgtgtgtgt |
37410737 |
T |
 |
| Q |
619 |
gagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||| |||| |||| ||||||||||| |
|
|
| T |
37410736 |
gagtttataatggttttgttattttgtctatctacc |
37410701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 73; E-Value: 7e-33
Query Start/End: Original strand, 526 - 653
Target Start/End: Complemental strand, 38678288 - 38678163
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||||||||| |||||||| || ||||| |||||| | |||||||||||||||||| ||||||| |||||| ||||| |||||||||||||| |
|
|
| T |
38678288 |
agaagtcctagctcaattggcaaaa--tgtagaaatagttaggtcagatgccatgaccggggtttgaaccccagtacctccacttgtgtgtgtgagttta |
38678191 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
38678190 |
taatggctttgccatttcgtctatctac |
38678163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 73; E-Value: 7e-33
Query Start/End: Original strand, 574 - 654
Target Start/End: Complemental strand, 40012068 - 40011988
Alignment:
| Q |
574 |
tgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40012068 |
tgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtctatctacc |
40011988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 6369552 - 6369654
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| || ||||| ||||||| ||||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6369552 |
aaaatgccgaaattgttaggccggatgtcatgatcgtggttc-aaccccgatacctccacttatgtgtgtgagtttataatggctttaccatttcgtcta |
6369650 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
6369651 |
tcta |
6369654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 6378017 - 6378119
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| || ||||| ||||||| ||||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6378017 |
aaaatgccgaaattgttaggccggatgtcatgatcgtggttc-aaccccgatacctccacttatgtgtgtgagtttataatggctttaccatttcgtcta |
6378115 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
6378116 |
tcta |
6378119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 7264429 - 7264532
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||| ||| ||||||| ||||||| |||||||| | |||||||| ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7264429 |
aaaatgccgaaattgtgaggtcggatgctatgaccgaggttcgaatctcggtacctccacttatgtgtgtgagtttataatgactttgccatttcgtcta |
7264528 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
7264529 |
tcta |
7264532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 548 - 654
Target Start/End: Complemental strand, 46021536 - 46021429
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttca-cttatgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||| || || ||||||||||||||| ||||||||||||| || || |
|
|
| T |
46021536 |
aaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccattttgtgtgtgtgagtttatgatggctttgccatctcttc |
46021437 |
T |
 |
| Q |
647 |
tatctacc |
654 |
Q |
| |
|
|||||||| |
|
|
| T |
46021436 |
tatctacc |
46021429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 44327638 - 44327769
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||| |||||||||| ||||||||| || | |||||||||||||||||| ||||||||| |||||||||| ||||| ||||| ||||||||| |
|
|
| T |
44327638 |
tatccagaattcctagctcaactggcaaaa--tgtcaaaattgttaggccggatgtcatgaccggaattcgaaccccaatacctccacttgtgtgtgtga |
44327735 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||| |
|
|
| T |
44327736 |
gtttataatagctttgtcatttcgtctatctacc |
44327769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 5523817 - 5523922
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||||||||| || | ||||| |||||||| ||||||| |||||||||||||| ||||||||||| |
|
|
| T |
5523817 |
aaaatgtcgaaattgttaggtcggatgccatgaccggggttcgaatcctgatacctccacttatgcgtgtgagattataatggctttgtcatttcgtcta |
5523916 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
5523917 |
tctacc |
5523922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 48467810 - 48467939
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
|||||||| |||||||||| ||||||||| || |||||||||||| ||||||| ||||| ||||||||||||| ||||||| ||||| |||||| ||| |
|
|
| T |
48467810 |
atccagaaatcctagctcaactggcaaaatat--cgaaattgttagaccggatgttatgac-ggggttcgaaccctggtacctccacttgtgtgtgcgag |
48467906 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
48467907 |
tttataatggctttgtcatttcgtctatctacc |
48467939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 558 - 654
Target Start/End: Original strand, 990248 - 990344
Alignment:
| Q |
558 |
aaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||| ||||||| ||||||||| ||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
990248 |
aaattgttaggccggatgctatgatcggggttcgaaccctggtacctccacttatgtttgtgagtttataatggctttgccatttagtccatctacc |
990344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 522 - 649
Target Start/End: Complemental strand, 22752963 - 22752838
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| ||||||||||||| || | |||| || ||||||||| ||||||||||| |||| ||||||||||||||| |||||| ||||||||||| |||| |
|
|
| T |
22752963 |
atccataagtcctagctcaactagaaaaatat--cgaaattgtaaggccggatgctatgatcggggttcgaaccccagtacctccacttatgtgtatgag |
22752866 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
||||||||| |||||||||||||||||| |
|
|
| T |
22752865 |
tttataatgactttgccatttcgtctat |
22752838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 521 - 652
Target Start/End: Complemental strand, 37117975 - 37117846
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||| ||||| || |||||||||||| |||||||||||| ||||||||||| || |||| || ||||| ||||||||| |
|
|
| T |
37117975 |
tatccagaagtcctagctcaactgacaaaa--tgttgaaattgttaggtcggatgccatgatcggggttcgaatcctggtaactccacttgtgtgtgtga |
37117878 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||| |||||||| |||||| |
|
|
| T |
37117877 |
gtttataatggctttgtcatttcgtttatcta |
37117846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 521 - 652
Target Start/End: Original strand, 45946708 - 45946837
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||| ||||||||||||| ||| ||||| |||| ||||| |||||||||||||||| || || ||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
45946708 |
tatccaaaagtcctagctcaactgacaaaa--tgccaaaattattaggccggatgccattactggagttcgaacctcggtacctccacttgtgtgtgtga |
45946805 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||| |||||||||| ||||||||||||||| |
|
|
| T |
45946806 |
gtttacaatggctttgtcatttcgtctatcta |
45946837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 522 - 628
Target Start/End: Complemental strand, 32251464 - 32251360
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||| ||| ||||||||| |||||||||||||| | |||||| |||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
32251464 |
atccagaagtcctagttcaactggcaaaa--tgccgaaattgttaagtcggatgtcatgaccggggttcgaaccccgatacctccacttatgtgtgtgag |
32251367 |
T |
 |
| Q |
622 |
tttataa |
628 |
Q |
| |
|
||||||| |
|
|
| T |
32251366 |
tttataa |
32251360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 43188528 - 43188661
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcact--tatgtgtgtg |
619 |
Q |
| |
|
|||||||||| |||||||| |||||||| |||||||||||||||||||| |||||||||| ||||||||||||| ||||| |||| | |||||||| |
|
|
| T |
43188528 |
atccagaagtactagctcaagtggcaaaa-atgccgaaattgttaggccgcatgccatgactagggttcgaaccccaatacctccacttgtgtgtgtgtg |
43188626 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
43188627 |
agtttataatgactttgtcatttcgtctatctacc |
43188661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 556 - 653
Target Start/End: Original strand, 8856308 - 8856403
Alignment:
| Q |
556 |
cgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||| ||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8856308 |
cgaaattgttaggccggataccatgaccggagttcgaaccctggtacctctactt--gtgtgtgagtttataatggctttgccatttcgtctatctac |
8856403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 33906305 - 33906410
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttca--cttatgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
|||||||| |||||||||||||||| | |||||||||||||||||| ||||||||| || ||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33906305 |
aaaatgccaaaattgttaggccggacgtcatgaccggggttcgaacaccggtacctccacgcttgtgtgtgtgagtttataatggctttgtcatttcgtc |
33906404 |
T |
 |
| Q |
647 |
tatcta |
652 |
Q |
| |
|
|||||| |
|
|
| T |
33906405 |
tatcta |
33906410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 41862811 - 41862914
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| ||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||| ||||||| |||||||| |||||| ||||||||||| |
|
|
| T |
41862811 |
aaaatgtcgaaattgttaggtcggatgtcataaccggggttcgaaccccggtaccttcactta--tgtgtgaatttataatagctttgtcatttcgtcta |
41862908 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
41862909 |
tctacc |
41862914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 47182802 - 47182933
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| ||||||||||||| ||||||||| |||| |||||||||| ||||||||||||| | ||||||||||||||||| || || || |||| ||||| |
|
|
| T |
47182802 |
atccataagtcctagctcaactggcaaaa--tgccaaaattgttagaccggatgccatgatcagggttcgaaccccggtatctccatttgtgtgagtgag |
47182899 |
T |
 |
| Q |
622 |
tttataatggctttgcca-tttcgtctatctacc |
654 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||| |
|
|
| T |
47182900 |
tttataacggctttgccattttcgtctatctacc |
47182933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 14817451 - 14817556
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| | |||||||||||||||||||||||| |||||||||||||| ||||||| ||||| ||||| |||||||| |||| ||||| ||||||||||| |
|
|
| T |
14817451 |
aaaatgtcaaaattgttaggccggatgccatgatcggggttcgaaccctggtacctccacttgtgtgtatgagtttacaatgactttgtcatttcgtcta |
14817550 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
14817551 |
tctacc |
14817556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 15264447 - 15264552
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| | |||||||||||||||||||||||| |||||||||||||| ||||||| ||||| ||||| |||||||| |||| ||||| ||||||||||| |
|
|
| T |
15264447 |
aaaatgtcaaaattgttaggccggatgccatgatcggggttcgaaccctggtacctccacttgtgtgtatgagtttacaatgactttgtcatttcgtcta |
15264546 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
15264547 |
tctacc |
15264552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 521 - 652
Target Start/End: Complemental strand, 40857470 - 40857343
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||| |||| || ||||||||||||| |||||||||||| |||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
40857470 |
tatccagaagtcctagctcaaatggtaaaa--tgtcgaaattgttaggtcggatgccatgatcggggttcgaaccccggtacctccacttatg--tgtga |
40857375 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||| ||||| ||||||||||||||| |
|
|
| T |
40857374 |
atttataataactttgtcatttcgtctatcta |
40857343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 525 - 652
Target Start/End: Complemental strand, 3043942 - 3043817
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| || | |||||| ||||||||||||||||||| ||||| || |||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
3043942 |
cagaagtcctagctcaattg--ataaaatgttgaaattgttaggccggatgtcatgattggagttcgaaccccgatacctccacttatgtgtgtgagttt |
3043845 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||| |||||| |||||||||||||| |
|
|
| T |
3043844 |
ataatgactttgcaatttcgtctatcta |
3043817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 520 - 654
Target Start/End: Complemental strand, 5222704 - 5222574
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
|||||||||||||||| |||| |||| |||| |||||||||||||| | ||||| ||||| ||||||||||||||| |||||| ||||| || |||| |
|
|
| T |
5222704 |
gtatccagaagtcctaactcaactggtaaaa--tgccgaaattgttaagttggatgtcatgatcggggttcgaaccccagtacctccactt--gtatgtg |
5222609 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5222608 |
agtttataatgactttgccatttcgtctatctacc |
5222574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 528 - 654
Target Start/End: Complemental strand, 13769746 - 13769624
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttata |
627 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||| ||||||| ||||||||||| ||||||||||||||||| |||| ||||||||| |||||| |
|
|
| T |
13769746 |
aagtcctagctcaattggcaaaa--tgccgaaattgttgggccggactccatgaccgggattcgaaccccggtacctccact--tgtgtgtgattttata |
13769651 |
T |
 |
| Q |
628 |
atggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| |||||||| |||||||| |
|
|
| T |
13769650 |
atggctttgtcatttcgtttatctacc |
13769624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 531 - 653
Target Start/End: Complemental strand, 10704011 - 10703891
Alignment:
| Q |
531 |
tcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatg |
630 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||| | ||| ||| | |||||||||| ||||||| ||||| ||||||||||||||||||| |
|
|
| T |
10704011 |
tcctagctcaactggcaaaa--tgccgaaattgttaggccgtacgccttgatcaaggttcgaaccttggtacctccacttctgtgtgtgagtttataatg |
10703914 |
T |
 |
| Q |
631 |
gctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||| |||||||||||||||| |
|
|
| T |
10703913 |
gctttgtcatttcgtctatctac |
10703891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 521 - 652
Target Start/End: Original strand, 30627621 - 30627751
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||| || ||||||||||| ||| |||||| || |||||||||||| |||||| ||||| || ||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
30627621 |
tatcctgatgtcctagctcaactgacaaaaa-tgtcgaaattgttagatcggatgtcatgatcgaggttcgaaccccggtacctccacttgtgtgtgtga |
30627719 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||| |||| ||||| ||||||||||||||| |
|
|
| T |
30627720 |
gtttacaatgactttgtcatttcgtctatcta |
30627751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 558 - 653
Target Start/End: Complemental strand, 35376955 - 35376860
Alignment:
| Q |
558 |
aaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||| ||||| ||||||| || || |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35376955 |
aaattgttaggccggatgccatgatcggagttcaaaccctggtacctccatttgtgtgtgagagtttataatggctttgccatttcgtctatctac |
35376860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 549 - 650
Target Start/End: Complemental strand, 19563199 - 19563100
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||| |||| |||||| || |||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
19563199 |
aaaatgccgaaattgttaggtcggatgccatgatcggggtttgaactccggtatctccacttatgtgtgtgag--tataatggctttgccaattcgtcta |
19563102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 40873210 - 40873312
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacct-tcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| ||||| |||| ||||| |
|
|
| T |
40873210 |
aaaatgccgaaattattaggctggatgccatgaccggggttcgaaccccggtacctcccact--tgtgtgtgagtttataatgcctttgtcattccgtct |
40873307 |
T |
 |
| Q |
648 |
atcta |
652 |
Q |
| |
|
||||| |
|
|
| T |
40873308 |
atcta |
40873312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 61; E-Value: 1e-25
Query Start/End: Original strand, 555 - 651
Target Start/End: Original strand, 36254157 - 36254252
Alignment:
| Q |
555 |
ccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatct |
651 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||||| |||||||| ||||| ||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
36254157 |
ccgaaattgttaggccg-atgccatgactagggttcgaaccacggtacctccacttgtgtgtgtgagtttataatgactttgccatttcgtatatct |
36254252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 521 - 652
Target Start/End: Complemental strand, 46715821 - 46715691
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||| |||||||||| |||| ||| |||||||| |||||||||||||| | ||||||||||||||||||||||||| ||||| ||||| | |||||| |
|
|
| T |
46715821 |
tatctagaagtcctaactcaactga-aaaaaatgtcgaaattgttaggcagaatgccatgaccggggttcgaaccccactacctccacttgtccgtgtga |
46715723 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||| ||||| |||| |||||||||| |
|
|
| T |
46715722 |
gtttataatgactttgtcattccgtctatcta |
46715691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 523 - 653
Target Start/End: Original strand, 40677017 - 40677146
Alignment:
| Q |
523 |
tccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagt |
622 |
Q |
| |
|
|||| ||||||||| ||| ||||||||| |||| |||||||||||||| | ||||||||||||||||||| | |||||| |||| ||||||||||| |
|
|
| T |
40677017 |
tccacaagtcctagttcaattggcaaaaa-tgccaaaattgttaggccgaacaccatgaccggggttcgaactctcgtacctctacttgtgtgtgtgagt |
40677115 |
T |
 |
| Q |
623 |
ttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||| |||||| |||||||||||||||| |
|
|
| T |
40677116 |
ttataatagctttgtcatttcgtctatctac |
40677146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 520 - 652
Target Start/End: Original strand, 24382588 - 24382718
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
|||| ||||||| |||||||| |||| |||| | |||||||||||||| ||||||| |||| ||||||||||| ||| ||||| ||||| ||||| || |
|
|
| T |
24382588 |
gtattcagaagttctagctcaactggtaaaata--ccgaaattgttaggtcggatgctatgattggggttcgaactccgttacctccacttgtgtgtatg |
24382685 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||| |||| |||||||||||||||| |
|
|
| T |
24382686 |
agtttataatgacttttccatttcgtctatcta |
24382718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 549 - 652
Target Start/End: Complemental strand, 24829168 - 24829066
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| ||||||||||||| ||||||| |||| |||||||||||| || ||| ||||||||||||||||||||||| |||| || || ||||||||||| |
|
|
| T |
24829168 |
aaaatgtcgaaattgttaggtcggatgc-atgatcggggttcgaactccagtatcttcacttatgtgtgtgagtttacaatgactgtgtcatttcgtcta |
24829070 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
24829069 |
tcta |
24829066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 591 - 654
Target Start/End: Original strand, 28382644 - 28382707
Alignment:
| Q |
591 |
gaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28382644 |
gaaccccggtacctccacttctgtgtgtgagtttataatggctttgccatttcgtctatctacc |
28382707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 548 - 654
Target Start/End: Original strand, 36251673 - 36251780
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
|||||||| ||||||||||||||||| | |||| ||| |||||||||||||||| | ||| |||||||||||||||||| |||| |||||||| ||||| |
|
|
| T |
36251673 |
aaaaatgctgaaattgttaggccggacgtcatggccgaggttcgaaccccggtatttccactttatgtgtgtgagtttatgatggttttgccatctcgtc |
36251772 |
T |
 |
| Q |
647 |
tatctacc |
654 |
Q |
| |
|
|||||||| |
|
|
| T |
36251773 |
tatctacc |
36251780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 549 - 654
Target Start/End: Complemental strand, 9932282 - 9932176
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag-tttataatggctttgccatttcgtct |
647 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||| |||||||||| | ||| | ||||||| |||||||| ||||||||| ||||| |||||||||| |
|
|
| T |
9932282 |
aaaatgccgaaattgttaggttggatgccatgatcggagttcgaaccctgatacttccacttatatgtgtgagttttataatgactttgacatttcgtct |
9932183 |
T |
 |
| Q |
648 |
atctacc |
654 |
Q |
| |
|
||||||| |
|
|
| T |
9932182 |
atctacc |
9932176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 526 - 616
Target Start/End: Complemental strand, 43416413 - 43416324
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgt |
616 |
Q |
| |
|
|||||| ||| |||| |||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
43416413 |
agaagttctaactcaactggcaaaaa-tgccgatattgttaggccggataccatgaccggggttcgaaccccggtacctccacttgtgtgt |
43416324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 576 - 649
Target Start/End: Complemental strand, 11075019 - 11074946
Alignment:
| Q |
576 |
ccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
|||||| ||| ||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11075019 |
ccatgatcggagttcgaaatccggtaccttcacttatgtatgtgagtttataatggctttgccatttcgtctat |
11074946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 548 - 654
Target Start/End: Complemental strand, 12645403 - 12645296
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
||||||| |||||||||||||||||| | ||||||| |||||||||||| |||||| ||| ||||||||||| |||||| |||| |||| ||| ||||| |
|
|
| T |
12645403 |
aaaaatgtcgaaattgttaggccggacgtaatgaccgaggttcgaacccctgtacctccactttatgtgtgtgggtttatgatggttttgtcatctcgtc |
12645304 |
T |
 |
| Q |
647 |
tatctacc |
654 |
Q |
| |
|
|||||||| |
|
|
| T |
12645303 |
tatctacc |
12645296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 20182805 - 20182908
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||||| | |||||| ||||| ||||||||||| ||||||||| |||| |||||||||||||| |||| |||||| |||| ||||| |
|
|
| T |
20182805 |
aaaatgccgaaattgttacgtcggatgttatgactggggttcgaactccggtacctccactagtgtgtgtgagtttacaatgactttgcaatttggtcta |
20182904 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
20182905 |
tcta |
20182908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 556 - 654
Target Start/End: Original strand, 16862419 - 16862517
Alignment:
| Q |
556 |
cgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||| | ||||| | | ||||||||||||| |||| ||||| ||||||||||||||| ||| ||||| ||||||| ||||||||| |
|
|
| T |
16862419 |
cgaaattgttaggccggacgtcatgatcagagttcgaaccccggcacctccacttgtgtgtgtgagtttatgatgactttgtcatttcgcctatctacc |
16862517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 549 - 650
Target Start/End: Complemental strand, 31807151 - 31807052
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||| ||||||| ||||| |||||| | |||||||| ||| ||||| |||||||| ||||||||||||||| ||||| ||||||||||| |
|
|
| T |
31807151 |
aaaatgccgaaattattaggccagatgctatgaccagagttcgaacaccgttacctccacttatg--tgtgagtttataatgactttgtcatttcgtcta |
31807054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 548 - 650
Target Start/End: Complemental strand, 10084404 - 10084308
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| ||| |||||| |||| ||||||||| ||||||| ||||| |||||||||| |
|
|
| T |
10084404 |
aaaaatgccgaaattgttaagccggatgccatgaccggggttcgaatccc-gtacctccact--tgtgtgtga---tataatgactttgtcatttcgtct |
10084311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 521 - 652
Target Start/End: Original strand, 41780261 - 41780388
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||||||||| |||| || |||||| || ||||||||||||| ||||| |||||||||||||||||||| ||||||| ||| ||||||||| |
|
|
| T |
41780261 |
tatccagaagtcctaactcaactagcaaaa--tgtcgaaattgttaggttggatgtcatgaccggggttcgaaccctggtacctccac--gtgtgtgtga |
41780356 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||| |||| ||||||||| ||||| |
|
|
| T |
41780357 |
gtttataataattttgtcatttcgtccatcta |
41780388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 23138648 - 23138782
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg-- |
619 |
Q |
| |
|
||||||||||||||||| | |||| |||| ||| |||||||||||| |||||| ||||| |||||| ||||| ||||| || ||||| ||||||| |
|
|
| T |
23138648 |
atccagaagtcctagcttaactggtaaaa--tgctgaaattgttaggtcggatgttatgactggggtttgaacctcggtatctccacttgcgtgtgtgtg |
23138745 |
T |
 |
| Q |
620 |
--agtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
23138746 |
agagtttataatggctttgctatttcgtctatctacc |
23138782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 556 - 652
Target Start/End: Complemental strand, 28649463 - 28649367
Alignment:
| Q |
556 |
cgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||| |||||| ||||| || ||||||||| |||||||| ||||| ||||||||||||||||||| |||| ||||||| ||||||| |
|
|
| T |
28649463 |
cgaaattgttaggtcggatgtcatgatcgaagttcgaacctcggtacctccacttgtgtgtgtgagtttataatgactttatcatttcgactatcta |
28649367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 549 - 645
Target Start/End: Original strand, 47459440 - 47459536
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgt |
645 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||| ||||| ||| | |||||| || |||| |||| ||||||||||||||||||| ||||||| |
|
|
| T |
47459440 |
aaaatgtcgaaattgttaggccggatgtcatgaccgaggttcaaactcaggtacccccatttatttgtgcgagtttataatggctttgctatttcgt |
47459536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 549 - 653
Target Start/End: Original strand, 28234950 - 28235056
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtt--tataatggctttgccatttcgtc |
646 |
Q |
| |
|
|||||||||| |||||||||||||| | ||| ||||||||| ||||||| |||||| ||||| | |||||||||| |||||||| |||| ||| ||||| |
|
|
| T |
28234950 |
aaaatgccgatattgttaggccggacgtcataaccggggtttgaaccccagtacctccacttgtatgtgtgagtttatataatggttttgtcatctcgtc |
28235049 |
T |
 |
| Q |
647 |
tatctac |
653 |
Q |
| |
|
||||||| |
|
|
| T |
28235050 |
tatctac |
28235056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 45594824 - 45594927
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||| || ||| ||| | |||||| ||||| |||||||||||| |||||||||||| ||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
45594824 |
aaaatgctgagattattaagtcggatgtcatgatcggggttcgaacatttgtaccttcacttgtgtgtgtgagtttataatgactttgtcatttcgtcta |
45594923 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
45594924 |
tcta |
45594927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 583 - 649
Target Start/End: Complemental strand, 788928 - 788862
Alignment:
| Q |
583 |
cggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
|||||||||||||||||| ||| ||||| |||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
788928 |
cggggttcgaaccccggtgcctccacttgtgtgtgtgagtttataatagctttgtcatttcgtctat |
788862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 558 - 652
Target Start/End: Complemental strand, 27339823 - 27339729
Alignment:
| Q |
558 |
aaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||| ||||||| ||||||| |||| |||| ||||| || ||||| ||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
27339823 |
aaattgttagaccggatgttatgaccgtagttcaaacctcggtatctccacttgtgtgtgtgagtttataatgactttgtcatttcgtctatcta |
27339729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 35196899 - 35197002
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||| ||||||||| ||||||| |||||| ||||||||||||||||| ||||| |||||||| || |
|
|
| T |
35196899 |
aaaatgccgaaatcgttaggctggatgccatgactaaggttcgaactatggtacctccactta--tgtgtgagtttataatgactttgtcatttcgtata |
35196996 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
35196997 |
tctacc |
35197002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 548 - 654
Target Start/End: Complemental strand, 41708647 - 41708542
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||| | ||||||||||| |||||| |||| |||||||||||||||| ||||| ||||| ||| ||||||||||| |||||||| |||| || ||| |
|
|
| T |
41708647 |
aaaaatgtcaaaattgttaggtcggatgttatgatcggggttcgaaccccgatacctccactt-tgtatgtgagtttatgatggctttaccatctcttct |
41708549 |
T |
 |
| Q |
648 |
atctacc |
654 |
Q |
| |
|
||||||| |
|
|
| T |
41708548 |
atctacc |
41708542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 10092698 - 10092803
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||| ||||||||||| || ||| | || || ||||||||| ||| ||| | ||| |||||||||||| |
|
|
| T |
10092698 |
aaaatgccgaaattattaggccggatgtcatgaccagggttcgaacctcgatacatccatttgtgtgtgtgaacttacaatagttttaccatttcgtcta |
10092797 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
10092798 |
tctacc |
10092803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 586 - 652
Target Start/End: Complemental strand, 42653234 - 42653166
Alignment:
| Q |
586 |
ggttcgaaccccgg--taccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||| |||||||| |||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42653234 |
ggttcgaaccccggagtaccttcaattatatgtgtaagtttataatggctttgccatttcgtctatcta |
42653166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 2682026 - 2681895
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| ||||||||||||| |||||||| ||| ||||| ||||||||||||| |||||| | |||| ||||||| || | ||||| ||||| |||| |
|
|
| T |
2682026 |
atccataagtcctagctcaatcggcaaaaa-tgctgaaatcgttaggccggatgtcatgacagaagttcaaaccccgataaatccacttgtgtgtatgag |
2681928 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| ||||| ||||| ||||||||||| |
|
|
| T |
2681927 |
tttataatgactttgacattttgtctatctacc |
2681895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 550 - 653
Target Start/End: Complemental strand, 25648259 - 25648156
Alignment:
| Q |
550 |
aaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
||||| |||||||||||||| | | || ||| |||||||||||| ||| |||| ||||||||| ||| | ||||||||||||||| |||||||||||| |
|
|
| T |
25648259 |
aaatgtcgaaattgttaggctgaacgctttgattggggttcgaaccgcggcacctccacttatgtatgtaaatttataatggctttgtcatttcgtctat |
25648160 |
T |
 |
| Q |
650 |
ctac |
653 |
Q |
| |
|
|||| |
|
|
| T |
25648159 |
ctac |
25648156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 577 - 652
Target Start/End: Original strand, 39303689 - 39303764
Alignment:
| Q |
577 |
catgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||| | | |||||||| |||||| ||||| ||||||||| |
|
|
| T |
39303689 |
catgactggggttcgaaccccggtacctccacttatgtgtataaatttataatagctttgtcattttgtctatcta |
39303764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 558 - 652
Target Start/End: Complemental strand, 6071231 - 6071138
Alignment:
| Q |
558 |
aaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||||| |||| |||| ||||||| |||||| |||||||| ||||||||| |||| |||| |||| ||||||||||||||| |
|
|
| T |
6071231 |
aaattgttaggccggatgttatgatcggg-ttcgaactccggtatcttcacttgtgtgtgtgaatttaaaatgattttgtcatttcgtctatcta |
6071138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 558 - 654
Target Start/End: Complemental strand, 9506937 - 9506840
Alignment:
| Q |
558 |
aaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||| ||||||||| ||| || ||||||||||||||| ||||| || |||| || |||||||||| |
|
|
| T |
9506937 |
aaattgttaggccggacatcatgaccgaggttcgaactccggtacctccactttgtgtgtgtgagtttatgatggccttaccatctcttctatctacc |
9506840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 557 - 654
Target Start/End: Complemental strand, 48401385 - 48401288
Alignment:
| Q |
557 |
gaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||| ||||||| |||| ||||||||| | |||||||||| | || ||||||||| |||| |||| ||||| |||||| |||||||||| |
|
|
| T |
48401385 |
gaaattgttaggtcggatgctatgatcggggttcgtattccggtacctttatttgtgtgtgtgaatttacaatgactttgtcatttcttctatctacc |
48401288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 556 - 652
Target Start/End: Complemental strand, 28019977 - 28019881
Alignment:
| Q |
556 |
cgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||| ||||| ||||| ||||||||||| ||||||||| ||||| | ||| |||||||||||||| |||| ||||| |||||||| |
|
|
| T |
28019977 |
cgaaattgttaggatggatgtcatgattggggttcgaactccggtacctccacttgtatgtatgagtttataatggttttgtcattttatctatcta |
28019881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 523 - 649
Target Start/End: Complemental strand, 5841607 - 5841483
Alignment:
| Q |
523 |
tccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagt |
622 |
Q |
| |
|
|||| ||||||||||||| ||| |||| || ||||||||||||| |||| |||||| ||| |||||| ||||||| || ||| | ||| || | || |
|
|
| T |
5841607 |
tccacaagtcctagctcaattggtaaaatat--cgaaattgttaggtcggacaccatgatcggatttcgaatcccggtaactccacctgtgtatgcgggt |
5841510 |
T |
 |
| Q |
623 |
ttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
5841509 |
ttataatggctttgccatttcgtctat |
5841483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 548 - 654
Target Start/End: Complemental strand, 12961929 - 12961822
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttc-acttatgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
||||||| ||||||||||||||||| ||||| ||| ||||||||| |||||||||| | || ||||||||||||||| ||| ||||| ||| || || |
|
|
| T |
12961929 |
aaaaatgtagaaattgttaggccggacatcatgatcggagttcgaacctcggtaccttcaatttgtgtgtgtgagtttatgatgactttgtcatctcttc |
12961830 |
T |
 |
| Q |
647 |
tatctacc |
654 |
Q |
| |
|
|||||||| |
|
|
| T |
12961829 |
tatctacc |
12961822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 30552428 - 30552531
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||||||| | |||| |||||| ||||||||||| ||| | ||||||| || ||||||||||||| ||||| ||||||||||| |
|
|
| T |
30552428 |
aaaatgccgaaattgttaggtcagatgtcatgactggggttcgaactataatacttccacttatatgcgtgagtttataataactttgtcatttcgtcta |
30552527 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
30552528 |
tcta |
30552531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 528 - 654
Target Start/End: Complemental strand, 45957458 - 45957332
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttat |
626 |
Q |
| |
|
||||||||||||| ||||||||| |||| ||||||||| ||||| | ||||| | |||||||||||||||||||| ||| || ||||||| ||||||| |
|
|
| T |
45957458 |
aagtcctagctcaattggcaaaaa-tgccaaaattgttaaaccggacgtcatgatcagggttcgaaccccggtacctccactttgtgtgtgttagtttat |
45957360 |
T |
 |
| Q |
627 |
aatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
| | ||||| ||| || |||||||||| |
|
|
| T |
45957359 |
gaagactttgtcatctcttctatctacc |
45957332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 556 - 647
Target Start/End: Original strand, 32986134 - 32986229
Alignment:
| Q |
556 |
cgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtg----tgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||||||||| ||||||| |||| |||||||||||| |||| ||| ||||||||||| |||| |||||||||||||| |||||||||| |
|
|
| T |
32986134 |
cgaaattgttagggcggatgctatgattggggttcgaacctcggttcctctacttatgtgtgtgaatgagcttataatggctttgtcatttcgtct |
32986229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 548 - 650
Target Start/End: Original strand, 35289869 - 35289970
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
|||||||| |||||||||||| | || | ||||| ||||||||||| | ||||||| || || ||||||||||||||| ||||||||||||| ||| || |
|
|
| T |
35289869 |
aaaaatgctgaaattgttaggtcagacgtcatgattggggttcgaactctggtacctccattt-tgtgtgtgagtttatgatggctttgccatctcgact |
35289967 |
T |
 |
| Q |
648 |
atc |
650 |
Q |
| |
|
||| |
|
|
| T |
35289968 |
atc |
35289970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 522 - 635
Target Start/End: Complemental strand, 38930407 - 38930296
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||| || | |||||||||||| | ||| ||||| |||||| |||| |||||||| ||||| ||||||| || |
|
|
| T |
38930407 |
atccagaagtcctagctcaattggcaaag--tgtcaaaattgttaggctgaatgtcatgattggggtttgaacttcggtacctccacttgtgtgtgtaag |
38930310 |
T |
 |
| Q |
622 |
tttataatggcttt |
635 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
38930309 |
tttataatggcttt |
38930296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 528 - 636
Target Start/End: Complemental strand, 6328298 - 6328190
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttat |
626 |
Q |
| |
|
||||| ||||||| |||||||||| || | ||||||||||| ||| | |||||| |||||||||||||| ||||| ||| |||||||||||||||||| |
|
|
| T |
6328298 |
aagtcttagctcaactggcaaaaa-tgtcaaaattgttaggttggacgtcatgactagggttcgaaccccgatacctccactttatgtgtgtgagtttat |
6328200 |
T |
 |
| Q |
627 |
aatggctttg |
636 |
Q |
| |
|
|||| |||| |
|
|
| T |
6328199 |
gatggttttg |
6328190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 578 - 634
Target Start/End: Complemental strand, 5723678 - 5723622
Alignment:
| Q |
578 |
atgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctt |
634 |
Q |
| |
|
|||||||| |||||||| ||| ||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
5723678 |
atgaccggagttcgaactccgatacctccacttgtgtgtgtgagtttataatggctt |
5723622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 602 - 654
Target Start/End: Complemental strand, 9908000 - 9907948
Alignment:
| Q |
602 |
ccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| | |||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
9908000 |
ccttcacttgtatgtgtgagtttataatggttttgtcatttcgtctatctacc |
9907948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 526 - 596
Target Start/End: Complemental strand, 31770656 - 31770589
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
596 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| |||||||||| ||||||| |||||||||||| |
|
|
| T |
31770656 |
agaagtcctagctcaactggcaaa---tgccgaaattgcaaggccggatgtcatgacccgggttcgaaccc |
31770589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 548 - 653
Target Start/End: Original strand, 8059868 - 8059974
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
||||||| | ||||||||||| ||| | ||||| |||||||||||||||||||||| || || | ||||||||||| | ||| ||||| ||| ||||| |
|
|
| T |
8059868 |
aaaaatgtcaaaattgttaggtcgggcgtcatgatcggggttcgaaccccggtacctcaactttgtatgtgtgagtttgtcatgactttgtcatctcgtc |
8059967 |
T |
 |
| Q |
647 |
tatctac |
653 |
Q |
| |
|
||||||| |
|
|
| T |
8059968 |
tatctac |
8059974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 557 - 654
Target Start/End: Complemental strand, 26336475 - 26336379
Alignment:
| Q |
557 |
gaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||| || ||||| |||||||||| ||||||||| ||||||| | ||||| |||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
26336475 |
gaaattgttaagctggatgtcatgaccggg-ttcgaacccaggtacctctccacttgtgtatgagtttataatagctttgctgtttcgtctatctacc |
26336379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 521 - 649
Target Start/End: Original strand, 18110430 - 18110557
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||| |||| |||||||| |||| ||||| |||| |||| |||||| | ||| | ||| | ||||||||| ||||||||| ||| || ||| ||| |
|
|
| T |
18110430 |
tatccacaagttctagctcaactggtaaaaa-tgccaaaatagttaggtcagatactctgatctaggttcgaactccggtacctccacatacgtgcttga |
18110528 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
|||||||||| |||| ||||||||||||| |
|
|
| T |
18110529 |
gtttataatgacttttccatttcgtctat |
18110557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 528 - 654
Target Start/End: Complemental strand, 38504647 - 38504523
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttata |
627 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| |||||||||| || |||| ||||| ||||||||| ||| |||| ||||||||||||| | |
|
|
| T |
38504647 |
aagtcctagctcaattggcaaaaa-tgccgaaatttttaggccggacgctgtgacaagggtttgaaccccggctcctccact--tgtgtgtgagtttcca |
38504551 |
T |
 |
| Q |
628 |
atggct-ttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||| || |||||| |||||||||| |
|
|
| T |
38504550 |
atggctattatcatttcatctatctacc |
38504523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 612 - 652
Target Start/End: Complemental strand, 47182326 - 47182286
Alignment:
| Q |
612 |
tgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
47182326 |
tgtgtgtgattttataatggctttgccattttgtctatcta |
47182286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 548 - 654
Target Start/End: Original strand, 8037567 - 8037674
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcactt-atgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
|||||| |||||||| ||||| ||| | ||||| ||| |||||||| || |||||| || || |||||| ||||||||| ||| |||||||| ||||| |
|
|
| T |
8037567 |
aaaaataccgaaattattaggttggacgtcatgatcggagttcgaactccagtacctccattttatgtgtatgagtttatgatgattttgccatctcgtc |
8037666 |
T |
 |
| Q |
647 |
tatctacc |
654 |
Q |
| |
|
|||||||| |
|
|
| T |
8037667 |
tatctacc |
8037674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 583 - 653
Target Start/End: Original strand, 34823735 - 34823802
Alignment:
| Q |
583 |
cggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||||| ||||| ||||| ||| |||| ||||||||| ||||| |||||||||||||||| |
|
|
| T |
34823735 |
cggggttcgaaccccg-tacctccacttgtgtatgtg--tttataatgactttgtcatttcgtctatctac |
34823802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 614 - 649
Target Start/End: Original strand, 42254615 - 42254650
Alignment:
| Q |
614 |
tgtgtgagtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42254615 |
tgtgtgagtttataatggctttgccatttcatctat |
42254650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 535 - 652
Target Start/End: Complemental strand, 44136245 - 44136127
Alignment:
| Q |
535 |
agctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc-cggtaccttcactta-tgtgtgtgagtttataatggc |
632 |
Q |
| |
|
|||||| |||||||||| | |||||||||||||| || | | ||| ||||| |||||||||| || ||||| ||||| |||||||||||||| ||| | |
|
|
| T |
44136245 |
agctcaactggcaaaaa-taccgaaattgttaggtcgaacgacataaccggagttcgaaccctcgatacctccactttgtgtgtgtgagtttaagatgac |
44136147 |
T |
 |
| Q |
633 |
tttgccatttcgtctatcta |
652 |
Q |
| |
|
|||| |||||||||||||| |
|
|
| T |
44136146 |
tttgtaatttcgtctatcta |
44136127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 526 - 595
Target Start/End: Complemental strand, 47250375 - 47250309
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaacc |
595 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| |||||||| | ||||||| ||||||||||| |
|
|
| T |
47250375 |
agaagtcctagctcaactggcaaa---tgccgaaattgcaaggccggacgtcatgacccgggttcgaacc |
47250309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 607 - 653
Target Start/End: Complemental strand, 8522833 - 8522787
Alignment:
| Q |
607 |
acttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||| ||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
8522833 |
acttgtgtgtgtgagtttataatgactttgttatttcgtctatctac |
8522787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 606 - 652
Target Start/End: Original strand, 35364271 - 35364317
Alignment:
| Q |
606 |
cacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||| || ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35364271 |
cacttgtgcgtgtgagtttataataactttgccatttcgtctatcta |
35364317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 559 - 649
Target Start/End: Complemental strand, 13847052 - 13846966
Alignment:
| Q |
559 |
aattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||| ||| |||||||| | |||||| |||||||| |||||| |||||||||||| |
|
|
| T |
13847052 |
aattgttaggccgaatgccatgaccggaattcgaatcccaataccttcaat----tgtgtgtgtttataaaagctttgtcatttcgtctat |
13846966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 557 - 650
Target Start/End: Original strand, 38397514 - 38397606
Alignment:
| Q |
557 |
gaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatc |
650 |
Q |
| |
|
||||||||||| ||||||| |||| | ||||||||| || ||||| ||||| ||||||||||| |||||| ||||| ||||||||||||| |
|
|
| T |
38397514 |
gaaattgttagatcggatgcaatgatcagggttcgaatcctaatacctccacttgcgtgtgtgagtt-ataatgactttgtcatttcgtctatc |
38397606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 114; Significance: 2e-57; HSPs: 173)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 2e-57
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 23311302 - 23311172
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23311302 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgag |
23311205 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
23311204 |
tttataatggctttgccatttcgtctatctacc |
23311172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 113; E-Value: 9e-57
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 23074774 - 23074643
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
23074774 |
atccagaagtcctagctcaactggcaaaaa-tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
23074676 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
23074675 |
tttataatggctttgccatttcgtctatctacc |
23074643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 110; E-Value: 5e-55
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 17869253 - 17869123
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
17869253 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgaa |
17869156 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
17869155 |
tttataatggctttgccatttcgtctatctacc |
17869123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 110; E-Value: 5e-55
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 36569278 - 36569408
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
36569278 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
36569375 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
36569376 |
tttataatggctttgccatttcgtctatctacc |
36569408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 107; E-Value: 3e-53
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 4164957 - 4165088
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
4164957 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
4165054 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
4165055 |
gtttataatggctttgccatttcgtctatctacc |
4165088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 107; E-Value: 3e-53
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 21728658 - 21728791
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
21728658 |
tatccagaagtcctagctcaactggcaaaa-atgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcctccacttatgtgtgtga |
21728756 |
T |
 |
| Q |
621 |
g-tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21728757 |
gttttataatggctttgccatttcgtctatctacc |
21728791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 107; E-Value: 3e-53
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 42448209 - 42448340
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
42448209 |
tatccagaagtcctagctcaactggcaaaa--tgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
42448306 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42448307 |
gtttataatggctttgccatttcgtctatctacc |
42448340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 106; E-Value: 1e-52
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 6672240 - 6672370
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
6672240 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
6672337 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
6672338 |
tttataatggttttgccatttcgtctatctacc |
6672370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 106; E-Value: 1e-52
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 18473913 - 18474043
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
18473913 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
18474010 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
18474011 |
gttataatggctttgccatttcgtctatctacc |
18474043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 104; E-Value: 2e-51
Query Start/End: Original strand, 535 - 654
Target Start/End: Original strand, 34856592 - 34856710
Alignment:
| Q |
535 |
agctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctt |
634 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34856592 |
agctcaactggcaaaa-atgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgagtttataatggctt |
34856690 |
T |
 |
| Q |
635 |
tgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
34856691 |
tgccatttcgtctatctacc |
34856710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 103; E-Value: 8e-51
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 25328434 - 25328303
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||| ||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
25328434 |
tatctagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccgaggttcgaaccccggtacctccacttgtgtgtgtga |
25328337 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
25328336 |
gtttataatggctttgccatttcgtctatctacc |
25328303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 103; E-Value: 8e-51
Query Start/End: Original strand, 525 - 654
Target Start/End: Original strand, 29119608 - 29119735
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| ||||||||||||| |
|
|
| T |
29119608 |
cagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
29119705 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
29119706 |
ataatggctttgccatttcgtctatctacc |
29119735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 102; E-Value: 3e-50
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 16496599 - 16496729
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||| ||| ||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
16496599 |
atccagaagtcctagttcaactggcaaaa--tgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
16496696 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
16496697 |
tttataatggctttgccatttcgtctatctacc |
16496729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 100; E-Value: 5e-49
Query Start/End: Original strand, 522 - 653
Target Start/End: Complemental strand, 1833449 - 1833319
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||| ||||||| |||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||||| |||||||||| |
|
|
| T |
1833449 |
atccagaagtcatagctcaactggcaaaaa-tgccgaaattgttaggccggataccatgaccggggttcgaaccccgatacctccacttgtgtgtgtgag |
1833351 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1833350 |
tttataatggctttgccatttcgtctatctac |
1833319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 100; E-Value: 5e-49
Query Start/End: Original strand, 522 - 653
Target Start/End: Complemental strand, 40318915 - 40318785
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||| ||||||| |||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||||| |||||||||| |
|
|
| T |
40318915 |
atccagaagtcatagctcaactggcaaaaa-tgccgaaattgttaggccggataccatgaccggggttcgaaccccgatacctccacttgtgtgtgtgag |
40318817 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
40318816 |
tttataatggctttgccatttcgtctatctac |
40318785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 99; E-Value: 2e-48
Query Start/End: Original strand, 524 - 653
Target Start/End: Original strand, 38682929 - 38683056
Alignment:
| Q |
524 |
ccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtt |
623 |
Q |
| |
|
||||||||||||||||| ||||||||| |||| |||||||||||| ||||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
38682929 |
ccagaagtcctagctcaactggcaaaa--tgccaaaattgttaggctggatgccatgaccggggttcgaaccccggtaccctcacttgtgtgtgtgagtt |
38683026 |
T |
 |
| Q |
624 |
tataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38683027 |
tataatggctttgccatttcgtctatctac |
38683056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 99; E-Value: 2e-48
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 39151056 - 39150925
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| |||| |||| || ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
39151056 |
tatccagaagtcctagctcaactggtaaaa--tgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
39150959 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
39150958 |
gtttataatggctttgacatttcgtctatctacc |
39150925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 99; E-Value: 2e-48
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 42068539 - 42068670
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
42068539 |
tatccagaagtcctagctcagctggcaaaa--tgccgaaattgttaggctggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
42068636 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||| | ||| ||||||||||| |
|
|
| T |
42068637 |
gtttataatggctttgtctttttgtctatctacc |
42068670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 98; E-Value: 8e-48
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 4617895 - 4617765
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| |||| |||| || ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
4617895 |
atccagaagtcctagctcaactggtaaaa--tgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
4617798 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
4617797 |
tttataatggctttgccatttcgtccatctacc |
4617765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 98; E-Value: 8e-48
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 9054100 - 9053970
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| | |||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||||| |
|
|
| T |
9054100 |
atccagaagtcctagctcaactggcaaaata--ccgaaattgttaggccggatgccatgaccggggttcgaaccccgatacctccacttgtgtgtgtgag |
9054003 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
9054002 |
tttataatggctttgtcatttcgtctatctacc |
9053970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 98; E-Value: 8e-48
Query Start/End: Original strand, 549 - 654
Target Start/End: Complemental strand, 27390031 - 27389926
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27390031 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaacctcggtacctccacttatgtgtgtgagtttataatggctttgccatttcgtcta |
27389932 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
27389931 |
tctacc |
27389926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 98; E-Value: 8e-48
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 34930249 - 34930354
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34930249 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtcta |
34930348 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
34930349 |
tctacc |
34930354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 98; E-Value: 8e-48
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 36790446 - 36790314
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||| ||||||||||||| | |||||||||| |||||||||| ||||||||||||| ||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
36790446 |
tatctagaagtcctagcttaactggcaaaaa-tgccgaaattattaggccggatgctatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
36790348 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
36790347 |
gtttataatggctttgccatttcgtctatctacc |
36790314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 98; E-Value: 8e-48
Query Start/End: Original strand, 549 - 654
Target Start/End: Complemental strand, 36854262 - 36854157
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36854262 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtcta |
36854163 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
36854162 |
tctacc |
36854157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 97; E-Value: 3e-47
Query Start/End: Original strand, 521 - 652
Target Start/End: Original strand, 29806565 - 29806694
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||| |||||||||| |||| |||| |||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29806565 |
tatccagaaatcctagctcaactggtaaaa--tgccaaaattgttaggccggatgccatgactggggttcgaaccccggtaccttcacttgtgtgtgtga |
29806662 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
29806663 |
gtttataatggctttgccatttcgtctatcta |
29806694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 96; E-Value: 1e-46
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 2103024 - 2103156
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |||| ||||||||||||||||| ||||| ||||||||| |
|
|
| T |
2103024 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgatcgggattcgaaccccggtacctacacttgtgtgtgtga |
2103121 |
T |
 |
| Q |
621 |
gtttataatggc-tttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
2103122 |
gtttataatggcttttgccatttcgtctatctacc |
2103156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 96; E-Value: 1e-46
Query Start/End: Original strand, 700 - 843
Target Start/End: Original strand, 35973064 - 35973210
Alignment:
| Q |
700 |
aatccgagttaaaaggttgtcccgataccaatttagattaacatataaatccttaacc--tttttgagttcaccttcc-aatgttcattttaaaccatgc |
796 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| ||||||| |||||||||| ||||||||||||||||| ||| |
|
|
| T |
35973064 |
aatccgagttaaaaggttgtcccaataccaatttatattaacatataaatccttaacccttttttgaattcaccttccaaatgttcattttaaaccgtgc |
35973163 |
T |
 |
| Q |
797 |
actttctagaatatgcattttctcaaggtttacttgttaaaggttca |
843 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||| |||||||| |
|
|
| T |
35973164 |
actttctagaatatgcattttgttaaggtttacttgtataaggttca |
35973210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 96; E-Value: 1e-46
Query Start/End: Original strand, 522 - 652
Target Start/End: Original strand, 41562457 - 41562585
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |||||||| ||||||||| ||||| |||||||||| |
|
|
| T |
41562457 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggagttcgaactccggtacctccacttgtgtgtgtgag |
41562554 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |
|
|
| T |
41562555 |
tttataatggctttgccatttcgtttatcta |
41562585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 525 - 654
Target Start/End: Complemental strand, 10393628 - 10393501
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
10393628 |
cagaagtcctagctcaactgg--aaaaatgccgaaattattaggccggatgccttgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
10393531 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |
|
|
| T |
10393530 |
ataatggctttgtcatttcgtctatctacc |
10393501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 1244310 - 1244180
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| ||||||| | |
|
|
| T |
1244310 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccctggtacctccacttgagtgtgtggg |
1244213 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
1244212 |
tttataatggctttgccatatcgtctatctacc |
1244180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 1650290 - 1650420
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| | |||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |||||||||| |
|
|
| T |
1650290 |
atccagaagtcctagctcaacctgcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaactccggtacctccacttgtgtgtgtgag |
1650387 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
1650388 |
tttataatggctttgccatttcgcctatctacc |
1650420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 93; E-Value: 8e-45
Query Start/End: Original strand, 519 - 654
Target Start/End: Original strand, 11968772 - 11968905
Alignment:
| Q |
519 |
agtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgt |
618 |
Q |
| |
|
||||||||||||||||| |||| ||| ||||| || |||||||||||||||||||||||||||||||||||||||||| |||||| ||||| ||||| | |
|
|
| T |
11968772 |
agtatccagaagtcctaactcaactgtcaaaa--tgtcgaaattgttaggccggatgccatgaccggggttcgaaccccagtacctccacttgtgtgtat |
11968869 |
T |
 |
| Q |
619 |
gagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
11968870 |
gagtttataatggctttgccatttcgtctatctacc |
11968905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 93; E-Value: 8e-45
Query Start/End: Original strand, 521 - 652
Target Start/End: Complemental strand, 24652444 - 24652315
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||||| || |||||||||||||| ||||| ||||||||| |
|
|
| T |
24652444 |
tatccagaagtcctaactcaactggcaaaa--tgtcgaaattgttaggccggatgccatgaccgggatttgaaccccggtacctccacttgtgtgtgtga |
24652347 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
24652346 |
gtttataatggctttgccatttcgtctatcta |
24652315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 92; E-Value: 3e-44
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 36726987 - 36727116
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| | ||||||| |
|
|
| T |
36726987 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggt--gaaccccggtacctccacttgtctgtgtga |
36727082 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
36727083 |
gtttataatgactttgccatttcgtctatctacc |
36727116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 91; E-Value: 1e-43
Query Start/End: Original strand, 525 - 653
Target Start/End: Complemental strand, 9902627 - 9902500
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag-tt |
623 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||||||||||||| |||| |||||||||||||||||||||| ||||| |||||||||| || |
|
|
| T |
9902627 |
cagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgctatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
9902530 |
T |
 |
| Q |
624 |
tataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9902529 |
tataatggctttgccatttcgtctatctac |
9902500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 91; E-Value: 1e-43
Query Start/End: Original strand, 529 - 654
Target Start/End: Original strand, 37191250 - 37191373
Alignment:
| Q |
529 |
agtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataa |
628 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||||||||||| ||||||||||| |||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37191250 |
agtcctagctcaactggcaaaa--tgccaaaattgttaggctggatgccatgatcgggattcgaaccccggtacctccacttatgtgtgtgagtttataa |
37191347 |
T |
 |
| Q |
629 |
tggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
37191348 |
tggctttgccatttcgtctatctacc |
37191373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 1287314 - 1287444
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||| |||| |||||||||||||||| |||||| |||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
1287314 |
atccagaagtcctagctcaattggtaaaa--tgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
1287411 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
1287412 |
tttataatggctttgccattacgtctatctacc |
1287444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 26802333 - 26802463
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||| || |||| ||||||||| |||| |||||||||||||| ||| |||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
26802333 |
atccagaagtcttaactcaactggcaaaa--tgccaaaattgttaggccgaatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
26802430 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
26802431 |
tttataatggctttgccatttcgtctatctacc |
26802463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 26809883 - 26810013
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||| || |||| ||||||||| |||| |||||||||||||| ||| |||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
26809883 |
atccagaagtcttaactcaactggcaaaa--tgccaaaattgttaggccgaatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
26809980 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
26809981 |
tttataatggctttgccatttcgtctatctacc |
26810013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 26824910 - 26825040
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||| || |||| ||||||||| |||| |||||||||||||| ||| |||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
26824910 |
atccagaagtcttaactcaactggcaaaa--tgccaaaattgttaggccgaatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
26825007 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
26825008 |
tttataatggctttgccatttcgtctatctacc |
26825040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 526 - 650
Target Start/End: Original strand, 37940921 - 37941043
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||||||||| ||||||||| || |||||||||||||||||||||||||| |||||||||||||||| ||||| ||||| |||||||||||||| |
|
|
| T |
37940921 |
agaagtcctagctcaactggcaaaa--tgtcgaaattgttaggccggatgccatgatcggggttcgaaccccgatacctccacttgtgtgtgtgagttta |
37941018 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatc |
650 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
37941019 |
taatggctttgccatttcgtctatc |
37941043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 1277436 - 1277567
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| ||| |||||||| |||||||| ||||| |||||||||| |
|
|
| T |
1277436 |
atccacaagtcctagctcagctgccaaaa-atgccgaaattgttaggccggatgccatgacagggattcgaacctcggtacctccacttgtgtgtgtgag |
1277534 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||| |
|
|
| T |
1277535 |
tttataatgactttgtcatttcgtctatctacc |
1277567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 522 - 653
Target Start/End: Original strand, 6029611 - 6029740
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| || | |||||||||||||||||| |||| | ||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
6029611 |
atccagaagtcctagctcaactggcaaaa--tgtcaaaattgttaggccggatgtcatgcctggggttcgaaccccggtacctccacttgtgtgtgtgag |
6029708 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6029709 |
tttataatggctttgccatttcgtctatctac |
6029740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 522 - 653
Target Start/End: Complemental strand, 24443996 - 24443867
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| | |||||||||||||| |||||| ||||||||||||| ||||||||||||| ||||| |||||||||| |
|
|
| T |
24443996 |
atccagaagtcctagctcaactggcaaaata--ccgaaattgttaggtcggatgttatgaccggggttcaaaccccggtacctccacttgtgtgtgtgag |
24443899 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
24443898 |
tttataatggctttgccatttcgtctatctac |
24443867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 522 - 653
Target Start/End: Complemental strand, 40045045 - 40044916
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||||||| |||||||||||||| ||||||||| || |||||| ||||| |||||||||| |
|
|
| T |
40045045 |
atccagaagttctagctcagctggcaaaa--tgccgaaattgttaggtcggatgccatgaccagggttcgaatcctagtacctccacttgtgtgtgtgag |
40044948 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
40044947 |
tttataatggctttgccatttcgtctatctac |
40044916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 88; E-Value: 7e-42
Query Start/End: Original strand, 520 - 654
Target Start/End: Original strand, 12665092 - 12665224
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
||||||||||||||||| ||| ||| ||||| |||||||||| ||||||||||||||||||||||||||||||| ||||||||| ||||| |||||||| |
|
|
| T |
12665092 |
gtatccagaagtcctagttcaactgacaaaa--tgccgaaattattaggccggatgccatgaccggggttcgaactccggtacctccacttgtgtgtgtg |
12665189 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
12665190 |
aatttataatggctttgccattttgtctatctacc |
12665224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 88; E-Value: 7e-42
Query Start/End: Original strand, 525 - 654
Target Start/End: Original strand, 39527934 - 39528059
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||| ||| |||| |||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
39527934 |
cagaagtcctagttcaactggtaaaa--tgccgaaattgttaggctggatgccatgaccggggttcgaaccccggtacctccact--tgtgtgtgagttt |
39528029 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39528030 |
ataatggctttgccatttcgtctatctacc |
39528059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 88; E-Value: 7e-42
Query Start/End: Original strand, 522 - 653
Target Start/End: Original strand, 41408625 - 41408755
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||| ||||||| ||||||||| ||||||||||||||||||||||| |||| |||||||||||||||||| ||||| ||||| |||||||||| |
|
|
| T |
41408625 |
atccagaagtcatagctcaactggcaaaa-atgccgaaattgttaggccggataccataaccggggttcgaaccccgatacctccacttgtgtgtgtgag |
41408723 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||| |||||| ||||||||||||||||| |
|
|
| T |
41408724 |
tttataacggctttaccatttcgtctatctac |
41408755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 9640663 - 9640533
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||| ||||||| ||||||||| |||||| |||||||||||| |||| || | |||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
9640663 |
atccagaagtcatagctcaactggcaaaa--tgccgatattgttaggccgaatgctataatcgggattcgaaccccggtacctccacttatgtgtgtgag |
9640566 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
9640565 |
tttataatggctttgccatttcgtctatctacc |
9640533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 85; E-Value: 5e-40
Query Start/End: Original strand, 522 - 653
Target Start/End: Complemental strand, 36319631 - 36319502
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| ||||||||||||| ||||||||| | | |||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
36319631 |
atccaaaagtcctagctcaactggcaaaata--ctgaaattgttaggccggatgccatgacaggggttcgaaccccggtacctccacttgtgtgtgtgaa |
36319534 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |
|
|
| T |
36319533 |
tttataatggctttgtcatttcgtctatctac |
36319502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 12878248 - 12878119
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||||||||| ||||| || |||||||||||| ||||| ||||| |||||||| |
|
|
| T |
12878248 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgatcgaagttcgaaccccgatacctccactt--gtgtgtga |
12878153 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
12878152 |
gtttataatggctttgccatttcgtctatctacc |
12878119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 519 - 654
Target Start/End: Complemental strand, 25567815 - 25567681
Alignment:
| Q |
519 |
agtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgt |
618 |
Q |
| |
|
|||||||| ||||||||| ||| |||||||||| ||| |||||| |||||||||||||||||| |||||||||||||||| ||||| ||||| ||||||| |
|
|
| T |
25567815 |
agtatccataagtcctagttcaactggcaaaaa-tgctgaaattattaggccggatgccatgatcggggttcgaaccccgttacctccacttctgtgtgt |
25567717 |
T |
 |
| Q |
619 |
gagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
25567716 |
gagtttataatggctttcccatttcgtctatatacc |
25567681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 521 - 631
Target Start/End: Complemental strand, 28143362 - 28143254
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
28143362 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgactggggttcgaaccccggtacctccacttgtgtgtgtga |
28143265 |
T |
 |
| Q |
621 |
gtttataatgg |
631 |
Q |
| |
|
||||||||||| |
|
|
| T |
28143264 |
gtttataatgg |
28143254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 528 - 654
Target Start/End: Original strand, 40595962 - 40596085
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttata |
627 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||||||||| |||||||||| ||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
40595962 |
aagtcctagctcaactggcaaaa--tgccgaaattgttaggccg-atgccatgactggggttcgaaccccggtacctccacttgtgtgtgtgagtttata |
40596058 |
T |
 |
| Q |
628 |
atggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||| ||||| ||||||||||||||||| |
|
|
| T |
40596059 |
atgactttgtcatttcgtctatctacc |
40596085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 671189 - 671058
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| |||||||||||||||| |||||| ||||| |||||||||||||||| ||||| ||| | ||||||||| |
|
|
| T |
671189 |
tatccagaagtcctagttcaactggcaaaa--tgccgaaattgttaggtcggatgtcatgatcggggttcgaaccccgatacctccacgtgtgtgtgtga |
671092 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
671091 |
gtttataatgactttgccatttcgtctatctacc |
671058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 18625745 - 18625614
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||||||||| |||| ||||||||| |||| |||||||||| || |||||||||| ||||||||||||||| |||||| ||||| | ||||||| |
|
|
| T |
18625745 |
tatccagaagtcctaactcaactggcaaaa--tgccaaaattgttagtccagatgccatgatcggggttcgaaccccagtacctccacttgtatgtgtga |
18625648 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
18625647 |
gtttataatggctttgccatttcgtctatctacc |
18625614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 525 - 654
Target Start/End: Complemental strand, 36246119 - 36245993
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
||||||||||| |||| ||| ||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
36246119 |
cagaagtcctaactcaactg--aaaaaatgc-gacattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
36246023 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||| ||||| ||||||||||||||||| |
|
|
| T |
36246022 |
ataatgactttgacatttcgtctatctacc |
36245993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 36259821 - 36259927
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgcca-tttcgtct |
647 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36259821 |
aaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaatcccggtacctccacttatgtgtgtgagtttataatggctttgccattttcgtct |
36259920 |
T |
 |
| Q |
648 |
atctacc |
654 |
Q |
| |
|
||||||| |
|
|
| T |
36259921 |
atctacc |
36259927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 522 - 650
Target Start/End: Complemental strand, 6041973 - 6041847
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| |||| |||| || ||||||| ||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
6041973 |
atccagaagtcctagctcaactggtaaaa--tgtcgaaattattaggccggatgctatgaccgggattcgaaccccggtaccttcacttgtgtgtgtgag |
6041876 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatc |
650 |
Q |
| |
|
|||||| ||||||||||||| |||||||| |
|
|
| T |
6041875 |
tttatattggctttgccattacgtctatc |
6041847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 519 - 654
Target Start/End: Original strand, 23310396 - 23310527
Alignment:
| Q |
519 |
agtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgt |
618 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| | || |||||||||||||||||||||||||| | |||| ||||||||||||| |||| ||||||| |
|
|
| T |
23310396 |
agtatccagaagtcctagctcaactggcaaaata--ccaaaattgttaggccggatgccatgaccagagttcaaaccccggtacctccact--tgtgtgt |
23310491 |
T |
 |
| Q |
619 |
gagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23310492 |
gaatttataatggctttgccatttcgtctatctacc |
23310527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 521 - 649
Target Start/End: Original strand, 33028228 - 33028354
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||| ||||||||||| ||| ||| ||||| |||| |||||||||||||||||| |||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
33028228 |
tatcaagaagtcctagttcaactgacaaaa--tgccaaaattgttaggccggatgtcatgaccggggttcgaaccccggtacttccacttatgtgtgtga |
33028325 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
||||||||||||||| ||||||||||||| |
|
|
| T |
33028326 |
gtttataatggctttaccatttcgtctat |
33028354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 33617095 - 33617225
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| |||| |||| |||||| ||||||||||||||||| |||| |||||||||||||||||| || ||||| |||||||||| |
|
|
| T |
33617095 |
atccagaagtcctagctcaactggtaaaa--tgccgacattgttaggccggatgctatgattggggttcgaaccccggtatctccacttgtgtgtgtgag |
33617192 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
33617193 |
tttattatggctttgccatttcgtctatctacc |
33617225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 36136991 - 36136861
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| || |||||| ||||||||||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
36136991 |
atccagaagtcctagctcaactagcaaaa--tgccgaaattgttaggccgaatgctatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
36136894 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||| |||| ||||||||||||||||| |
|
|
| T |
36136893 |
tttataataattttgtcatttcgtctatctacc |
36136861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 41071086 - 41071191
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||| |||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41071086 |
aaaatgccgaaattgttaggccgggtgccatgatcggagttcgaaccccgatacctccacttgtgtgtgtgagtttataatggctttgccatttcgtcta |
41071185 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
41071186 |
tctacc |
41071191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 549 - 653
Target Start/End: Complemental strand, 20695587 - 20695483
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20695587 |
aaaatgccgaaattgttaggcccgatgtcatgaccggggttcgaacccctatacctccacttgtgtgtgtgagtttataatggctttgccatttcgtcta |
20695488 |
T |
 |
| Q |
649 |
tctac |
653 |
Q |
| |
|
||||| |
|
|
| T |
20695487 |
tctac |
20695483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 26267130 - 26266998
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcact--tatgtgtgtg |
619 |
Q |
| |
|
||||||||||| ||||||| ||||||||| |||||||||||||| |||||||||||||| ||| ||||||||||||||||| |||| | |||||||| |
|
|
| T |
26267130 |
atccagaagtcgtagctcaactggcaaaa--tgccgaaattgttaagccggatgccatgatcggatttcgaaccccggtacctccacttgtgtgtgtgtg |
26267033 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
26267032 |
agtttataatggctttgccatttcgtctatctacc |
26266998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 557 - 653
Target Start/End: Original strand, 29622237 - 29622332
Alignment:
| Q |
557 |
gaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29622237 |
gaaattgttaggccggatgccatgaccggggttcgaaccccg-tacctccacttatgtgtgtgagtttataatggctttgctatttcgtctatctac |
29622332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 10165556 - 10165659
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| ||||| ||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
10165556 |
aaaatgccgaaattgttagaccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatgactttgctatttcgtcta |
10165655 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
10165656 |
tcta |
10165659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 528 - 654
Target Start/End: Complemental strand, 16371595 - 16371471
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttata |
627 |
Q |
| |
|
||||||||| ||| ||||||||| |||| |||||||||||| ||||| ||||| |||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
16371595 |
aagtcctagttcaactggcaaaa--tgccaaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttata |
16371498 |
T |
 |
| Q |
628 |
atggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||| |||||||||||||||||| |
|
|
| T |
16371497 |
atggctttaccatttcgtctatctacc |
16371471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 549 - 652
Target Start/End: Complemental strand, 43070788 - 43070685
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| | ||||||||||||||| ||| ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43070788 |
aaaatgccgaaattgttaggtcggatgccatgacggaggttcgaaccccggttcctccacttatgtgtgtgagtttataatgactttgccatttcgtcta |
43070689 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
43070688 |
tcta |
43070685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 1269649 - 1269518
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||| ||||| || |||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
1269649 |
tatccagaagtcctagctcaactgacaaaa--tgtcgaaattgttaggccggatgccatgattggggttcgaaccccggtacctccacttatttgtgtga |
1269552 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||| || |||||| |||||| |||||||||| |
|
|
| T |
1269551 |
gtttatgatagctttgtcatttcatctatctacc |
1269518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 14808833 - 14808964
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||||||||| ||| ||||||||| |||| ||||||||||||||||| |||||||| |||||||||| |||||| || |||||||||||||| |
|
|
| T |
14808833 |
tatccagaagtcctaattcaactggcaaaa--tgccaaaattgttaggccggatcccatgaccagggttcgaactccggtatctccacttatgtgtgtgg |
14808930 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
14808931 |
atttataatggctttgccatttcgtctatctacc |
14808964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 78; E-Value: 7e-36
Query Start/End: Original strand, 517 - 653
Target Start/End: Complemental strand, 12708010 - 12707876
Alignment:
| Q |
517 |
atagtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgt |
616 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||| |||||||||||||||| |||||||||| ||| | ||||||||||| ||||| ||||| ||||| |
|
|
| T |
12708010 |
atagaatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggtcggatgccatcaccagagttcgaaccccaatacctccacttgtgtgt |
12707913 |
T |
 |
| Q |
617 |
gtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
12707912 |
gtgagtttataatggttttaccatttcgtctatctac |
12707876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 522 - 653
Target Start/End: Original strand, 24051402 - 24051531
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
|||||||||||||| |||| ||||||||| ||| ||||| ||||||||||||||||||||||||||||||||| ||||||| ||||| ||| |||||| |
|
|
| T |
24051402 |
atccagaagtcctaactcaactggcaaaa--tgctaaaattattaggccggatgccatgaccggggttcgaaccctggtacctccacttgtgtatgtgag |
24051499 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||| ||||| |||||||||||||||| |
|
|
| T |
24051500 |
tttataatgactttgtcatttcgtctatctac |
24051531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 522 - 653
Target Start/End: Original strand, 34675746 - 34675875
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| | ||||||| |||||||||||||||| ||||||||||| |||| ||||||||||||||||| ||||| |||||||||| |
|
|
| T |
34675746 |
atccagaagtcctagctcaacaggcaaaa--tgccgaaattgttaggttggatgccatgatcgggattcgaaccccggtacctccacttgtgtgtgtgag |
34675843 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||| |||||||||||| ||||||||| |
|
|
| T |
34675844 |
tttataatagctttgccattttatctatctac |
34675875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 18115117 - 18115220
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| | ||||||||||||||||| || |||||||| |||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18115117 |
aaaatgtcaaaattgttaggccggataccgtgaccgggattcgaaacccggtacctccacttatgtgtgtgagtttataatggctttgccatttcgtcta |
18115216 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
18115217 |
tcta |
18115220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 526 - 652
Target Start/End: Complemental strand, 43150283 - 43150159
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
|||||||||| |||| ||||||||| || ||||||||||||||||||||| |||| ||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
43150283 |
agaagtcctaactcaactggcaaaa--tggcgaaattgttaggccggatgctatgattggggttcgaaccccggtacctccacttgtgtgtgtgagttta |
43150186 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||| |||| |||||||||||||||| |
|
|
| T |
43150185 |
taatgactttaccatttcgtctatcta |
43150159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 16906361 - 16906471
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-----ttatgtgtgtgagtttataatggctttgccatttc |
643 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
16906361 |
aaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgttgtgtgtgtgagtttataatggctttgccatttc |
16906460 |
T |
 |
| Q |
644 |
gtctatctacc |
654 |
Q |
| |
|
|||||||||| |
|
|
| T |
16906461 |
atctatctacc |
16906471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 521 - 653
Target Start/End: Original strand, 37067699 - 37067826
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||| |||||||||| |||| ||| ||||| ||||||||||||||||||||||||||||||||| ||||||||||| |||||| |||| ||||||||| |
|
|
| T |
37067699 |
tatctagaagtcctacctcaactgacaaaa--tgccgaaattgttaggccggatgccatgaccggagttcgaacccc-gtacctccact--tgtgtgtga |
37067793 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
37067794 |
gtttataatgactttgccatttcgtctatctac |
37067826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 549 - 649
Target Start/End: Complemental strand, 10154266 - 10154168
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| | |||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10154266 |
aaaatgccgaaattgtcaggccggatgccatgaccggggttcgaaccccggtacttccact--tgtgtgtgagtttatattggctttgccatttcgtcta |
10154169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 73; E-Value: 7e-33
Query Start/End: Original strand, 526 - 654
Target Start/End: Complemental strand, 972720 - 972593
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||||| ||| ||| |||||| || ||||||||||||| ||||||| |||||| |||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
972720 |
agaagtcctagttcaactgacaaaaa-tgtcgaaattgttaggtcggatgctatgaccagggttcgaaccccggtacctctacttgtgtgtgtgagttta |
972622 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||| ||||| ||||||||||||||||| |
|
|
| T |
972621 |
taatgactttgtcatttcgtctatctacc |
972593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 73; E-Value: 7e-33
Query Start/End: Original strand, 553 - 653
Target Start/End: Complemental strand, 29293622 - 29293522
Alignment:
| Q |
553 |
tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |||||||| ||||| |||||||||||| ||||| ||||||||||||| |||||||| |
|
|
| T |
29293622 |
tgccgaaattgttaggccggatgccatgatcggggttcgaacctcggtacctccacttgtgtgtgtgagttcataatagctttgccatttcatctatcta |
29293523 |
T |
 |
| Q |
653 |
c |
653 |
Q |
| |
|
| |
|
|
| T |
29293522 |
c |
29293522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 5203549 - 5203682
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcact--tatgtgtgtg |
619 |
Q |
| |
|
||||||||||| ||||||| |||||||| || ||||||||||||||||||||||||||||||||||||||||||| ||||| |||| | |||||||| |
|
|
| T |
5203549 |
atccagaagtcttagctcaagaggcaaaaa-tgtcgaaattgttaggccggatgccatgaccggggttcgaaccccgatacctccacttgtgtgtgtgtg |
5203647 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||| ||||| ||||| ||||||||||| |
|
|
| T |
5203648 |
agtttataatgactttgtcattttgtctatctacc |
5203682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 549 - 652
Target Start/End: Complemental strand, 40199208 - 40199105
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||||||||||||| ||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
40199208 |
aaaatgccgaaattgttaggctggatgtcatgatcgaagttcgaaccccggtacctccacttatgtatgtgagtttataatggttttgccatttcgtcta |
40199109 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
40199108 |
tcta |
40199105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 28489180 - 28489313
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccgg-taccttcacttatgtgtgtg |
619 |
Q |
| |
|
||||| |||||||||| ||| ||| |||||| |||||||||| ||||||||||||| |||| ||| |||||||||| | ||| |||||||||||||||| |
|
|
| T |
28489180 |
tatccggaagtcctagttcaactgacaaaaa-tgccgaaattattaggccggatgctatgattgggattcgaacccccgatactttcacttatgtgtgtg |
28489278 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28489279 |
agtttataatgactttgccatttcgtctatctacc |
28489313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 36185135 - 36185266
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||| |||||||||| ||||||||| || ||||||||||||| | ||| ||||| |||||||||||||||||||||| ||||| |||| |||| |
|
|
| T |
36185135 |
tatccagaaatcctagctcaactggcaaaa--tgtcgaaattgttaggtcagatatcatgatcggggttcgaaccccggtacctccacttgtgtgcgtga |
36185232 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
36185233 |
atttataatagctttgccatttcgtctatctacc |
36185266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 563 - 653
Target Start/End: Complemental strand, 38975828 - 38975738
Alignment:
| Q |
563 |
gttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||| ||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38975828 |
gttaggccggatgccacgaccggggttcgaactccggtacctccacttgtgtgtgtgagtttataatggctttgtcatttcgtctatctac |
38975738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 549 - 654
Target Start/End: Complemental strand, 4874349 - 4874244
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| ||||||||||||| |||||| |||| |||||||||||||||| ||||| || |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4874349 |
aaaatgtcgaaattgttaggacggatgttatgatcggggttcgaaccccgatacctccatttatgtatgtgagtttataatggctttgccatttcgtcta |
4874250 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
4874249 |
tctacc |
4874244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 521 - 649
Target Start/End: Original strand, 9068801 - 9068927
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||| ||||||||||||| |||| |||| || ||||||||||||| |||||||||||| |||||||||||||||||||||| || | ||||||||| |
|
|
| T |
9068801 |
tatccataagtcctagctcaactggtaaaa--tgtcgaaattgttaggtcggatgccatgatcggggttcgaaccccggtacctccattagtgtgtgtga |
9068898 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
|||||||||| ||||| |||||||||||| |
|
|
| T |
9068899 |
gtttataatgactttgtcatttcgtctat |
9068927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 517 - 653
Target Start/End: Complemental strand, 12769259 - 12769125
Alignment:
| Q |
517 |
atagtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgt |
616 |
Q |
| |
|
|||| ||||| ||||||||||||| |||| |||| |||||||||||||||| |||||||||| ||| | ||||||||||| ||||| ||||| ||||| |
|
|
| T |
12769259 |
atagaatccaaaagtcctagctcaactggtaaaa--tgccgaaattgttaggtcggatgccatcaccagagttcgaaccccaatacctccacttgtgtgt |
12769162 |
T |
 |
| Q |
617 |
gtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
12769161 |
gtgagtttataatggttttaccatttcgtctatctac |
12769125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 526 - 652
Target Start/End: Complemental strand, 6053176 - 6053055
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||||||||| ||| ||||| |||||||||||||||| |||||| |||||||||||||||||||||||||||| |||||| | |||||||||| |
|
|
| T |
6053176 |
agaagtcctagctcaactgacaaaa--tgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggtacctccactta--tatgtgagttta |
6053081 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||| |||| ||||||||||||||| |
|
|
| T |
6053080 |
taatgg-tttgtcatttcgtctatcta |
6053055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 557 - 653
Target Start/End: Original strand, 14126935 - 14127031
Alignment:
| Q |
557 |
gaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||||||||| ||||| |||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
14126935 |
gaaattgttaggccggatctcatgaccggggttcgaatcccggtacctccacttgtgtgtgcgagtttataatggctttgtcatttcgtctatctac |
14127031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 549 - 653
Target Start/End: Complemental strand, 19867385 - 19867281
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||||||||||||||||| | | ||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| ||||||| ||| |
|
|
| T |
19867385 |
aaaatgccgaaattgttaggcttcacgtcatgaccggggttcgaaccccagtaccttcacttatgtgtgtgagtttataatgactttgtcatttcgccta |
19867286 |
T |
 |
| Q |
649 |
tctac |
653 |
Q |
| |
|
||||| |
|
|
| T |
19867285 |
tctac |
19867281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 549 - 650
Target Start/End: Complemental strand, 4430045 - 4429944
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||| ||||||| ||||| |||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
4430045 |
aaaatgtcgaaattgttaggccggatgtcatgaccggggttcaaaccccgatacctccacttatgtgtgtgagtttataataactttatcatttcgtcta |
4429946 |
T |
 |
| Q |
649 |
tc |
650 |
Q |
| |
|
|| |
|
|
| T |
4429945 |
tc |
4429944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 549 - 654
Target Start/End: Complemental strand, 6219294 - 6219190
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||| ||||||||||||||| |||||| ||||||||| |||||||||| ||||| | || || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6219294 |
aaaacgccgaaattgttaggtcggatgtcatgaccggtgttcgaaccctggtac-tccatttgtgtgtgtgagtttataatggctttgccatttcgtcta |
6219196 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
6219195 |
tctacc |
6219190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 521 - 653
Target Start/End: Original strand, 8487395 - 8487525
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||| |||| |||||||||| ||||||||| |||| ||||||||| || ||||| ||||||||||||| ||| | |||||||| ||||| ||||||||| |
|
|
| T |
8487395 |
tatctagaaatcctagctcaactggcaaaa--tgccaaaattgttaagctggatgtcatgaccggggtttgaatctcggtacctccacttgtgtgtgtga |
8487492 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||| |||||| |||||||||||||| |
|
|
| T |
8487493 |
gtttataatggttttgccgtttcgtctatctac |
8487525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 10011468 - 10011601
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatg--tgtgt |
618 |
Q |
| |
|
|||||| ||||||||||||| | || |||| || ||||||||||||| |||||||||||| ||| |||||||| ||||||||| |||||||| ||||| |
|
|
| T |
10011468 |
tatccaaaagtcctagctcaaccggtaaaa--tgtcgaaattgttaggtcggatgccatgatcggagttcgaactccggtacctccacttatgtatgtgt |
10011565 |
T |
 |
| Q |
619 |
gagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
10011566 |
gaatttataatggctttgtcatttcgtctatctacc |
10011601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 522 - 649
Target Start/End: Complemental strand, 7179430 - 7179305
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
|||||||||| |||||||| ||||||||| || ||||||||||||||| ||||||||||||||| ||| || || |||||| |||||||||||||||| |
|
|
| T |
7179430 |
atccagaagttctagctcaactggcaaaa--tgtcgaaattgttaggccagatgccatgaccgggattcaaatccttgtacctccacttatgtgtgtgag |
7179333 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
|||||||| | |||| |||||||||||| |
|
|
| T |
7179332 |
tttataatagttttgtcatttcgtctat |
7179305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 523 - 654
Target Start/End: Complemental strand, 12638596 - 12638468
Alignment:
| Q |
523 |
tccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagt |
622 |
Q |
| |
|
|||| ||||||||||||| || | |||| || |||||||||||||||||| ||| |||| ||||||||||||||| | ||| ||||| ||||||||||| |
|
|
| T |
12638596 |
tccaaaagtcctagctcaactagtaaaatat--cgaaattgttaggccggacgccttgacgggggttcgaaccccg-tccctccacttgtgtgtgtgagt |
12638500 |
T |
 |
| Q |
623 |
ttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |
|
|
| T |
12638499 |
ttataatggttttgccatttcgtctatctacc |
12638468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 561 - 653
Target Start/End: Complemental strand, 16667123 - 16667031
Alignment:
| Q |
561 |
ttgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||| ||||| |||||| |||| ||||||| |||||||||||||||||||||| |
|
|
| T |
16667123 |
ttgttaggccagatgccatgatcggggttcgaaccccggtacctccacttctgtgtgagagtatataatgactttgccatttcgtctatctac |
16667031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 528 - 652
Target Start/End: Complemental strand, 27004088 - 27003964
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtg--tgtgagttta |
625 |
Q |
| |
|
||||||||||||| |||| |||| ||||||||||||||| | ||||||||||| ||||||||||| ||||| |||| |||||||||| |||||||||| |
|
|
| T |
27004088 |
aagtcctagctcaactggtaaaa--tgccgaaattgttagtctggatgccatgatcggggttcgaatcccggcacctccacttatgtgtgtgtgagttta |
27003991 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||| ||||| ||||||||||||||| |
|
|
| T |
27003990 |
taatgactttgtcatttcgtctatcta |
27003964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 521 - 653
Target Start/End: Original strand, 32466567 - 32466699
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcactta--tgtgtgt |
618 |
Q |
| |
|
|||||||||||||||| ||| ||| | |||||| ||||||| ||||||||||||| |||||||| |||||||||||| ||||| |||||| ||||||| |
|
|
| T |
32466567 |
tatccagaagtcctagttcaactg--ataaaatgtcgaaattattaggccggatgctatgaccggagttcgaaccccgatacctccacttatgtgtgtgt |
32466664 |
T |
 |
| Q |
619 |
gagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|| ||||||||||||||| |||||| ||||||||| |
|
|
| T |
32466665 |
gaatttataatggctttgtcatttcatctatctac |
32466699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 525 - 654
Target Start/End: Original strand, 17080467 - 17080594
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||| ||||||| ||| ||||| || ||||||||||| | |||||| |||||| |||||||||||| |||||||| ||||||||||||||| ||| |
|
|
| T |
17080467 |
cagaagtcgtagctcaactgacaaaa--tgtcgaaattgttaagtcggatgtcatgacgggggttcgaacctcggtacctccacttatgtgtgtgaattt |
17080564 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||| |||| ||||||||||||||||| |
|
|
| T |
17080565 |
ataatgattttgtcatttcgtctatctacc |
17080594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 549 - 654
Target Start/End: Complemental strand, 32274080 - 32273977
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||| |||||||||||| ||||| |||||||||||||||||||||||||| || | || ||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
32274080 |
aaaatgctgaaattgttagggcggataccatgaccggggttcgaaccccggtaactccgct--tgtgtgtgagtttataatgactttgtcatttcgtcta |
32273983 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
32273982 |
tctacc |
32273977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 521 - 652
Target Start/End: Original strand, 4228855 - 4228982
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||| || |||||||||| ||||||||| || |||||||||||| ||| || |||||| |||||||| |||||||||| | |||||||||| ||| |
|
|
| T |
4228855 |
tatccataaatcctagctcaactggcaaaa--tgtcgaaattgttagaccgaataccatgatcggggttccaaccccggtatttccacttatgtg--tga |
4228950 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4228951 |
gtttataatggctttgccatttcgtctatcta |
4228982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 565 - 654
Target Start/End: Original strand, 9716327 - 9716416
Alignment:
| Q |
565 |
taggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |||| ||| ||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9716327 |
taggccagatgccatgaccggggttcgaaccccggtacctctacttgtgtctgtaagtttataatggctttgtcatttcgtctatctacc |
9716416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 549 - 650
Target Start/End: Complemental strand, 12819649 - 12819549
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||||||| ||| |||||| |||| |||| ||||| |||||||||||||| | |||||||||||||||||||||| |||||||||||| |
|
|
| T |
12819649 |
aaaatgccgaaattgttaggtcgg-tgccataaccgtggtttgaacctcggtaccttcacttgtatgtgtgagtttataatggctttaccatttcgtcta |
12819551 |
T |
 |
| Q |
649 |
tc |
650 |
Q |
| |
|
|| |
|
|
| T |
12819550 |
tc |
12819549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 525 - 653
Target Start/End: Complemental strand, 19836213 - 19836087
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| ||||||||| || ||||||||||||| ||||||| |||||||| || | | |||||||||| ||||| || |||||||||| |
|
|
| T |
19836213 |
cagaagtcctagctcaactggcaaaa--tgtcgaaattgttaggtcggatgctgtgaccgggatttgtatcccggtacctccacttgtgcgtgtgagttt |
19836116 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||| ||||| |||||||||||||||| |
|
|
| T |
19836115 |
ataatgactttgtcatttcgtctatctac |
19836087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 39143439 - 39143573
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgt-- |
618 |
Q |
| |
|
|||||| ||||||||||||| ||||||||| || |||||||||||||||| |||||||||||| |||||||| |||||||||| ||||| ||||||| |
|
|
| T |
39143439 |
tatccacaagtcctagctcaactggcaaaa--tgtcgaaattgttaggccgaatgccatgaccgaggttcgaa-cccggtacctccacttgtgtgtgtgt |
39143535 |
T |
 |
| Q |
619 |
--gagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||| |||||| |||||||| ||||||| |
|
|
| T |
39143536 |
gcgagtttataatgactttgctatttcgtccatctacc |
39143573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 61; E-Value: 1e-25
Query Start/End: Original strand, 549 - 617
Target Start/End: Original strand, 14107276 - 14107344
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtg |
617 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14107276 |
aaaatgccgaaactgttaggccggatgccatgaccggggttcgaaccccggtacctccacttatgtgtg |
14107344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 61; E-Value: 1e-25
Query Start/End: Original strand, 557 - 653
Target Start/End: Original strand, 24637986 - 24638082
Alignment:
| Q |
557 |
gaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||| |||||||| ||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
24637986 |
gaaattgttaggccggatgtcatgattggggttcgaaccccggtttcttcacttgtgtgtgtgagtttataatgactttatcatttcgtctatctac |
24638082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 549 - 652
Target Start/End: Complemental strand, 2025785 - 2025683
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||| |||||||||||| |||||| ||||| |||||||||||| ||||||||| ||||||||||||||||||||||||| | ||| |||||| |||| |
|
|
| T |
2025785 |
aaaatgcggaaattgttaggtcggatgtcatgatcggggttcgaactccggtacctccacttatgtgtgtgagtttataatgac-ttgtcatttcatcta |
2025687 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
2025686 |
tcta |
2025683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 535 - 654
Target Start/End: Original strand, 5276358 - 5276475
Alignment:
| Q |
535 |
agctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctt |
634 |
Q |
| |
|
|||||| |||||||||| |||||||||| || ||||||||||||||||||||| |||||||||| ||| ||||| ||||||||||||| ||||| ||| |
|
|
| T |
5276358 |
agctcaactggcaaaaag-gccgaaattgctaagccggatgccatgaccggggt-cgaaccccggctcctccacttgtgtgtgtgagtttctaatgactt |
5276455 |
T |
 |
| Q |
635 |
tgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||| ||||||| |
|
|
| T |
5276456 |
tgccatttcgtccatctacc |
5276475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 548 - 652
Target Start/End: Complemental strand, 10109996 - 10109896
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||| ||| |||||||||||||||| |||||||| |||||||||| |||||||| |||| |||||||||||||||||||||||||||||| ||| |
|
|
| T |
10109996 |
aaaaatgtcgatattgttaggccggatgtcatgaccgaggttcgaacctcggtacctccact----tgtgtgagtttataatggctttgccatttcatct |
10109901 |
T |
 |
| Q |
648 |
atcta |
652 |
Q |
| |
|
||||| |
|
|
| T |
10109900 |
atcta |
10109896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 10458750 - 10458856
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgt-gagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||| |||||||||||||||||||||| ||||| | ||||| || ||||||||| ||||| ||||| |||| |
|
|
| T |
10458750 |
aaaatgccaaaattgttaggccggatgctatgatcggggttcgaaccccggtacctccacttgtatgtgtggattttataatgactttgtcattttgtct |
10458849 |
T |
 |
| Q |
648 |
atctacc |
654 |
Q |
| |
|
||||||| |
|
|
| T |
10458850 |
atctacc |
10458856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 528 - 654
Target Start/End: Complemental strand, 42645588 - 42645462
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgt--gtgtgagttta |
625 |
Q |
| |
|
||||||||||||| |||| |||| ||| ||||| |||| |||||| ||||| ||||||||||||| |||||||| ||||||||| ||||||||||| |
|
|
| T |
42645588 |
aagtcctagctcaactggtaaaa--tgctaaaattattagatcggatgtcatgatcggggttcgaacctcggtacctccacttatgtatgtgtgagttta |
42645491 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||| ||||||||||||||||| |
|
|
| T |
42645490 |
taatggctttgtcatttcgtctatctacc |
42645462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 42337972 - 42337842
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
|||||||| |||||||||| ||||||||| |||||||||||||||| |||||| ||| | ||| |||||||| | ||||||| ||||| |||||||||| |
|
|
| T |
42337972 |
atccagaattcctagctcaactggcaaaa--tgccgaaattgttaggtcggatgtcataatcggagttcgaactctggtacctccacttgtgtgtgtgag |
42337875 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||| |||| || | |||||| |||||||||| |
|
|
| T |
42337874 |
tttatgatggtttcgtcatttcatctatctacc |
42337842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 525 - 654
Target Start/End: Complemental strand, 23219246 - 23219113
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctt-cac-----ttatgtgtgt |
618 |
Q |
| |
|
||||||||||| |||| |||| |||| |||| |||||||||||||| ||||||||| ||||||||||||| ||||||||| ||| || ||||||| |
|
|
| T |
23219246 |
cagaagtcctaactcaactggtaaaa--tgccaaaattgttaggccgtatgccatgatcggggttcgaacctcggtaccttccacttgtgttgtgtgtgt |
23219149 |
T |
 |
| Q |
619 |
gagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
23219148 |
gagtttataatgactttgtcatttcgtctatctacc |
23219113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 521 - 651
Target Start/End: Original strand, 1612370 - 1612500
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||| ||||||| ||||| ||| |||||| || ||||||||||||||||| ||| |||| ||||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
1612370 |
tatccacaagtccttgctcaactgacaaaaa-tgttgaaattgttaggccggacatcataaccgcggttcgaaccccgatacctccacttgtgtgtgtga |
1612468 |
T |
 |
| Q |
621 |
gtttata-atggctttgccatttcgtctatct |
651 |
Q |
| |
|
||||||| ||||||||| |||||||||||||| |
|
|
| T |
1612469 |
gtttatatatggctttgtcatttcgtctatct |
1612500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 28391197 - 28391300
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||||||| || ||||||||| ||| |||||||||| | |||||| | |||||||||| | ||||||||| |||||||||||||||| |
|
|
| T |
28391197 |
aaaatgccgaaattgttaggtcgaatgccatgatcggagttcgaaccctgctaccttaatttatgtgtgtaaatttataatgaatttgccatttcgtcta |
28391296 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
28391297 |
tcta |
28391300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 574 - 653
Target Start/End: Complemental strand, 41958108 - 41958029
Alignment:
| Q |
574 |
tgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||| ||||||||||| |||||||| |||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
41958108 |
tgccatgaccagggttcgaacctcggtacctctacttgtgtgtgttagtttataatggctttgccatttcgtctatctac |
41958029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 521 - 646
Target Start/End: Complemental strand, 2706260 - 2706137
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||| | |||| |||| |||||||||| ||||| | ||||| |||| || |||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
2706260 |
tatccagaagtcctagcttaactggtaaaa--tgccgaaattattaggtcagatgctatgattggagttcgaactccgataccttcacttgtgtgtgtga |
2706163 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
||||||||||||||| ||||||||| |
|
|
| T |
2706162 |
atttataatggctttgtcatttcgtc |
2706137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 556 - 654
Target Start/End: Original strand, 28869981 - 28870079
Alignment:
| Q |
556 |
cgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||| ||| ||| ||| || ||||||||| ||| ||| ||||| |||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
28869981 |
cgaaattgttaggccgaatgtcataacctggattcgaaccctggtccctccacttgtgtgtgtgagtttataatggttttgtcatttcgtctatctacc |
28870079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 553 - 653
Target Start/End: Original strand, 7809604 - 7809703
Alignment:
| Q |
553 |
tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||| |||||| ||||| ||||| |||||||| ||||| |||||| ||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
7809604 |
tgccgaaattattaggc-ggatgtcatgatcggggttcaaaccctagtacctcaacttatgtgtgtgagtttataatggttttgtcatttcgtctatcta |
7809702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 521 - 652
Target Start/End: Complemental strand, 13549281 - 13549153
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||| | ||||||| ||||||||| || | ||||| ||||||||||| |||||| ||||||||||||||| ||||| |||||||| | ||| |
|
|
| T |
13549281 |
tatccagaaattatagctcaactggcaaaa--tgtcaaaatttttaggccggatatcatgacaggggttcgaaccccg-tacctccacttatgcatttga |
13549185 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |
|
|
| T |
13549184 |
gtttaaaatggctttgccatttcgtctatcta |
13549153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 561 - 649
Target Start/End: Complemental strand, 25984463 - 25984375
Alignment:
| Q |
561 |
ttgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
||||||||||||||||||||||| || |||||| ||||| || ||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
25984463 |
ttgttaggccggatgccatgaccaggattcgaatttcggtatctccacttatgtatgtaagtttataatggctttgccatttcgtctat |
25984375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 550 - 654
Target Start/End: Complemental strand, 31895615 - 31895511
Alignment:
| Q |
550 |
aaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||| ||||||||||||||||||| ||||| ||||| || ||||||||| | |||| |||||| ||||| |
|
|
| T |
31895615 |
aaatgccgaaattgttaggcaggatgtcatgactaaggttcgaaccccggtacctccacttgtgtgtatgggtttataattgttttgtcatttcatctat |
31895516 |
T |
 |
| Q |
650 |
ctacc |
654 |
Q |
| |
|
||||| |
|
|
| T |
31895515 |
ctacc |
31895511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 557 - 653
Target Start/End: Complemental strand, 35933073 - 35932977
Alignment:
| Q |
557 |
gaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||| |||| |||| ||||||||||||||| |||| | ||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35933073 |
gaaattgttaggttggatattatgatcggggttcgaaccccagtacttccacttatgtgtgtgagtttataatgattttgccatttcgtctatctac |
35932977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 522 - 652
Target Start/End: Original strand, 7670365 - 7670493
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| |||| |||||||| ||||||||| ||| |||||||||| ||||| ||||| |||||||||||||||||||| |||| |||||| ||| || |
|
|
| T |
7670365 |
atccataagttctagctcaactggcaaaa--tgctaaaattgttagatcggatatcatgatcggggttcgaaccccggtactttcatttatgtatgtaag |
7670462 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||| ||||||||| ||||| ||||||||| |
|
|
| T |
7670463 |
tttatgatggctttgtcattttgtctatcta |
7670493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 528 - 654
Target Start/End: Complemental strand, 8595611 - 8595480
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccg-------gggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||||||||| | |||||||| |||||||||||||||||||| ||||| ||| ||||| |
|
|
| T |
8595611 |
aagtcctagctcaactggcaaaaa-tgccgaaattgttaggccggacgtcatgaccgccgaccggggttcgaaccccggtacctccactt-tgtatgtga |
8595514 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
| |||| ||||| ||||||| || |||||||||| |
|
|
| T |
8595513 |
ggttatgatggcattgccatctcttctatctacc |
8595480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 13550379 - 13550248
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccgggg-ttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
||||||||| |||||||||| | ||||||| || || ||| |||||| |||| |||||||||||| ||||||||||| ||||| ||||| ||||||| |
|
|
| T |
13550379 |
tatccagaaatcctagctcaacgggcaaaa--tgttgagatttttaggctggataccatgaccgggggttcgaaccccg-tacctccacttgtgtgtgtc |
13550283 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|| ||| |||||||||||||||||||||||||||| |
|
|
| T |
13550282 |
agattaaaatggctttgccatttcgtctatctacc |
13550248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 528 - 654
Target Start/End: Complemental strand, 22792234 - 22792108
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttat |
626 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||||| |||| | | |||| ||||||||||||||| |||| ||| || ||||||||||||||| |
|
|
| T |
22792234 |
aagtcctagctcaactggcaaaaa-tgccgaaattgttaggtcggacgtcttgacaggggttcgaaccccgacacctccactttgtgtgtgtgagtttat |
22792136 |
T |
 |
| Q |
627 |
aatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||| ||||||||||| ||||| |||| |
|
|
| T |
22792135 |
gatgattttgccatttcttctatgtacc |
22792108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 526 - 652
Target Start/End: Original strand, 34174323 - 34174447
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||||||||| |||| |||| || | |||||||||| |||||||||||||| | ||||| ||| |||||| ||||| || | | |||||||||| |
|
|
| T |
34174323 |
agaagtcctagctcaactggtaaaa--tgacaaaattgttagaccggatgccatgactgaggttcaaactccggtatcttcatttgtatatgtgagttta |
34174420 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||| |||||| |||||||||||||| |
|
|
| T |
34174421 |
taatgactttgcaatttcgtctatcta |
34174447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 575 - 654
Target Start/End: Original strand, 39955743 - 39955822
Alignment:
| Q |
575 |
gccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||| ||||| ||||||||||||| | ||||| ||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
39955743 |
gccatgactggggtgcgaaccccggtacttccacttgtgtgtgtgagtttataatgactttgccacttcgtctatctacc |
39955822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 522 - 616
Target Start/End: Complemental strand, 15067270 - 15067177
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgt |
616 |
Q |
| |
|
|||||||| |||||||||| ||| |||||||| ||||||||||||||||||||| |||| |||||||||||||||||||| | ||||| ||||| |
|
|
| T |
15067270 |
atccagaattcctagctcaattgg-aaaaaatgtcgaaattgttaggccggatgctatgatcggggttcgaaccccggtacatccacttgtgtgt |
15067177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 528 - 649
Target Start/End: Original strand, 29069633 - 29069752
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttata |
627 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||||||||| ||| | ||| ||| | ||||||||||| |||||| ||||||| |||||||||||||| |
|
|
| T |
29069633 |
aagtcctagctcaactggcaaaata--ccgaaattgttaggttggacgacataaccagcgttcgaaccccagtacctccacttatatgtgtgagtttata |
29069730 |
T |
 |
| Q |
628 |
atggctttgccatttcgtctat |
649 |
Q |
| |
|
| |||||| |||||||||||| |
|
|
| T |
29069731 |
acagctttgtcatttcgtctat |
29069752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 549 - 639
Target Start/End: Complemental strand, 42559933 - 42559843
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgcca |
639 |
Q |
| |
|
|||||| |||||||||||||||||||| |||| || ||||| || ||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
42559933 |
aaaatgtcgaaattgttaggccggatgtaatgatcgaggttcaaattccggtacctccacttatgtgtgtgagtttataatggttttgcca |
42559843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 549 - 646
Target Start/End: Complemental strand, 1931193 - 1931096
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||| |||||||||||| | ||| || ||||| ||||||| | ||||||||| |||||| |||||||| |
|
|
| T |
1931193 |
aaaatgtcgaaattgttaggccggatgctatgactggggttcgaacctcagtatctccacttgtgtgtgtaaatttataatgactttgcaatttcgtc |
1931096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 549 - 654
Target Start/End: Complemental strand, 18990638 - 18990533
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||| |||||||||||| || | ||| |||||||||||||||||||||| || || || || || |||||||||||||||| |||| ||||||||||| |
|
|
| T |
18990638 |
aaaataccgaaattgttaagctgaatgtcatgaccggggttcgaaccccgatatctacatttgtgcgtgtgagtttataatgactttatcatttcgtcta |
18990539 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
18990538 |
tctacc |
18990533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 528 - 640
Target Start/End: Original strand, 26526517 - 26526629
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttat |
626 |
Q |
| |
|
||||| ||||||| |||||||||| | ||||||||||||||||| | | |||||||| ||||||||| ||||||||| ||| |||||||||||||||||| |
|
|
| T |
26526517 |
aagtcttagctcaactggcaaaaa-taccgaaattgttaggccgaacgtcatgaccgaggttcgaactccggtacctccactttatgtgtgtgagtttat |
26526615 |
T |
 |
| Q |
627 |
aatggctttgccat |
640 |
Q |
| |
|
||| |||||||| |
|
|
| T |
26526616 |
gatgaatttgccat |
26526629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 27389683 - 27389788
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||| ||||||||| |||| || ||||| ||||||| ||||||| ||||| ||||||||||||||||||||||||| ||||| ||||||| || |
|
|
| T |
27389683 |
aaaatgccaaaattgttaagccgaatatcatgatcggggtttaaaccccgatacctccacttatgtgtgtgagtttataatgactttgttatttcgtata |
27389782 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
27389783 |
tctacc |
27389788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 35232567 - 35232672
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| |||||||||||| || ||| ||||| |||||||| |||||| ||||||||||| ||||||||||||||||||| ||||| |||||||| | |
|
|
| T |
35232567 |
aaaatgacgaaattgttagatcgaatgtcatgattggggttcggaccccgataccttcacttgtgtgtgtgagtttataatgactttgtcatttcgtaga |
35232666 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
35232667 |
tctacc |
35232672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 525 - 652
Target Start/End: Complemental strand, 10070813 - 10070689
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| |||| |||| ||| |||||||||||| ||||||||||||| | ||||||||| ||| | |||||||||||||||||| |
|
|
| T |
10070813 |
cagaagtcctagctcaactggtaaaa--tgctgaaattgttaggtcggatgccatgactgaggttcgaacttaa-tacttctacttatgtgtgtgagttt |
10070717 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||| | |||||||||||||||||||| |
|
|
| T |
10070716 |
ataatagttttgccatttcgtctatcta |
10070689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 549 - 648
Target Start/End: Original strand, 22963712 - 22963809
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||| |||||| ||||| ||||| |||||| | ||||||||||||| |||||| |||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
22963712 |
aaaatgctgaaattattaggtcggataccatgatcagggttcgaaccccagtacctccacttacatgtg--agtttataatggctttgccatttcgtcta |
22963809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 549 - 652
Target Start/End: Complemental strand, 36034721 - 36034618
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||| ||||||||| |||||||| ||||||| |||||||| | |||| ||||||| ||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
36034721 |
aaaatgcaaaaattgttaaaccggatgctatgaccgaggttcgaatttcagtactttcacttgtgtgtgtgagtttataatgactttaccatttcgtcta |
36034622 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
36034621 |
tcta |
36034618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 525 - 654
Target Start/End: Original strand, 21067439 - 21067566
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| |||| |||| || ||||||||||||| |||| || |||| | |||||||||||| | | | ||||| ||||||||||||| |
|
|
| T |
21067439 |
cagaagtcctagctcaactggtaaaatat--cgaaattgttaggtcggacgctttgacggaggttcgaacccccgctcatccacttgtgtgtgtgagttt |
21067536 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||| ||||| ||||||||||||||||| |
|
|
| T |
21067537 |
ataataactttgtcatttcgtctatctacc |
21067566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 30528006 - 30528112
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||||||||||||||||||||| ||||| || | |||||||||||| |||| ||| || |||||||||||||| |||||||| ||||||| ||| |
|
|
| T |
30528006 |
aaaatgccgaaattgttaggccggacatcatgatcgagattcgaaccccggcacctccactttgtgtgtgtgagtttacgatggctttaccatttcttct |
30528105 |
T |
 |
| Q |
648 |
atctacc |
654 |
Q |
| |
|
||||||| |
|
|
| T |
30528106 |
atctacc |
30528112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 30568346 - 30568452
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||||||||||||||||||||| ||||| || | |||||||||||| |||| ||| || |||||||||||||| |||||||| ||||||| ||| |
|
|
| T |
30568346 |
aaaatgccgaaattgttaggccggacatcatgatcgagattcgaaccccggcacctccactttgtgtgtgtgagtttacgatggctttaccatttcttct |
30568445 |
T |
 |
| Q |
648 |
atctacc |
654 |
Q |
| |
|
||||||| |
|
|
| T |
30568446 |
atctacc |
30568452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 528 - 653
Target Start/End: Original strand, 11462741 - 11462864
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttata |
627 |
Q |
| |
|
||||||||||||| |||||||||| | |||||||||| || | | | |||||| ||||||||||||||| ||||||||||| | |||||||||||||| |
|
|
| T |
11462741 |
aagtcctagctcaactggcaaaaa-tatcgaaattgtttagcagaacgtcatgactggggttcgaaccccgataccttcactt-tatgtgtgagtttata |
11462838 |
T |
 |
| Q |
628 |
atggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||| |||| |||| || ||||||||| |
|
|
| T |
11462839 |
atgtctttaccatctcatctatctac |
11462864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 521 - 652
Target Start/End: Original strand, 19090432 - 19090564
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgt-- |
618 |
Q |
| |
|
|||||||||||| ||||||| |||| |||| || | ||||||||||||| |||||||| ||| |||||||||| || ||||| ||||||| ||||| |
|
|
| T |
19090432 |
tatccagaagtcttagctcaactggtaaaa--tgtcaaaattgttaggccagatgccataacctaggttcgaacctcgatacctccacttatatgtgtaa |
19090529 |
T |
 |
| Q |
619 |
-gagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| |
|
|
| T |
19090530 |
gtagtttataatgactttgtcatttcgtctatcta |
19090564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 588 - 652
Target Start/End: Complemental strand, 5494621 - 5494557
Alignment:
| Q |
588 |
ttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||| ||| | |||||||||||||| |
|
|
| T |
5494621 |
ttcgaaccccgatgccttcacttatgtgtgtgagtttataatggatttacgatttcgtctatcta |
5494557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 550 - 654
Target Start/End: Complemental strand, 9722177 - 9722073
Alignment:
| Q |
550 |
aaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
||||||| ||||||||| | |||| |||||| |||||||||||| ||||||||| |||| |||||| ||||||| |||| ||||| ||||| |||||| |
|
|
| T |
9722177 |
aaatgccaaaattgttaagttggataccatgatcggggttcgaacaccggtacctctacttgtgtgtgagagtttaaaatgactttgtcattttgtctat |
9722078 |
T |
 |
| Q |
650 |
ctacc |
654 |
Q |
| |
|
||||| |
|
|
| T |
9722077 |
ctacc |
9722073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 575 - 654
Target Start/End: Original strand, 29402062 - 29402139
Alignment:
| Q |
575 |
gccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||| | ||||||||||||||||||| ||||| |||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
29402062 |
gccatgactgaggttcgaaccccggtacctccactt--gtgtgtgagtttataatgattttgtcatttcgtctatctacc |
29402139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 599 - 654
Target Start/End: Complemental strand, 26310802 - 26310747
Alignment:
| Q |
599 |
gtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
26310802 |
gtaccttcacttgtgtgtgtgagtttataatgactttgtcatttcgtctatctacc |
26310747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 552 - 654
Target Start/End: Original strand, 12168279 - 12168379
Alignment:
| Q |
552 |
atgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatct |
651 |
Q |
| |
|
|||||||||| ||||||||||| ||||| ||| |||||||||||||||||||||||| | |||||||||||||||| |||||| ||| | ||||||| |
|
|
| T |
12168279 |
atgccgaaat-gttaggccggacatcatgatcggcgttcgaaccccggtaccttcactt-tatgtgtgagtttataatagctttgtcatcccatctatct |
12168376 |
T |
 |
| Q |
652 |
acc |
654 |
Q |
| |
|
||| |
|
|
| T |
12168377 |
acc |
12168379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 522 - 632
Target Start/End: Original strand, 12262869 - 12262978
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| ||||||||| ||| | ||||||| ||||||||||||||||| ||||| |||| |||||||||||||| |||||| ||||| ||||||||| |
|
|
| T |
12262869 |
atccaaaagtcctagttcaaccggcaaaa-atgccgaaattgttaggtcggatattatgatcggggttcgaacccaagtacctccacttgtgtgtgtgac |
12262967 |
T |
 |
| Q |
622 |
tttataatggc |
632 |
Q |
| |
|
|||| |||||| |
|
|
| T |
12262968 |
tttacaatggc |
12262978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 549 - 631
Target Start/End: Original strand, 42653565 - 42653647
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatgg |
631 |
Q |
| |
|
|||||| |||||||||||| ||||||| ||||||||||||| |||| || || || |||||||||||||||||||| ||||| |
|
|
| T |
42653565 |
aaaatgtcgaaattgttagaccggatgtcatgaccggggtttgaacttcgatatctccacttatgtgtgtgagtttaaaatgg |
42653647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 522 - 582
Target Start/End: Complemental strand, 22620780 - 22620722
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgac |
582 |
Q |
| |
|
||||||||||||||||||| ||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22620780 |
atccagaagtcctagctcaactgacaaaa--tgccgaaattgttaggccggatgccatgac |
22620722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 521 - 587
Target Start/End: Complemental strand, 4444977 - 4444914
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccgggg |
587 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||||||||| |||| |||||||||||| |
|
|
| T |
4444977 |
tatccagaagtcctagctcaactggcaaa---tgccgaaattgttaggctggataccatgaccgggg |
4444914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 550 - 649
Target Start/End: Complemental strand, 43370917 - 43370820
Alignment:
| Q |
550 |
aaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
||||||||||| |||||||||||| ||| ||| |||||||||| ||||| |||| || ||| |||||||||||||||||| |||| |||||| ||||| |
|
|
| T |
43370917 |
aaatgccgaaagtgttaggccggacgccttgatcggggttcgagccccgacacctccattta--tgtgtgagtttataatggttttgtcatttcatctat |
43370820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 547 - 652
Target Start/End: Complemental strand, 10084035 - 10083929
Alignment:
| Q |
547 |
aaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttataatggctttgccatttcgt |
645 |
Q |
| |
|
|||||||| ||||||| ||| | |||| | |||||||||||||||||| |||||| || ||| || ||||||| ||||||| ||| ||||||| | |||| |
|
|
| T |
10084035 |
aaaaaatgtcgaaattattaagtcggacgtcatgaccggggttcgaactccggtagctccactttgtgtgtgtaagtttatgatgactttgccctctcgt |
10083936 |
T |
 |
| Q |
646 |
ctatcta |
652 |
Q |
| |
|
||||||| |
|
|
| T |
10083935 |
ctatcta |
10083929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 600 - 653
Target Start/End: Complemental strand, 17986107 - 17986054
Alignment:
| Q |
600 |
taccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||| ||||| |||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
17986107 |
tacctccacttgtgtgtgtgagtttataatagctttgtcatttcgtctatctac |
17986054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #163
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 548 - 649
Target Start/End: Complemental strand, 24396552 - 24396451
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
|||||||| ||||||||||| | |||||| |||| || |||||||| | | || || |||||||||||| |||||||||| |||||| |||||||||| |
|
|
| T |
24396552 |
aaaaatgcagaaattgttagactggatgctatgattggagttcgaactctgatatctctacttatgtgtgtcagtttataatagctttgtcatttcgtct |
24396453 |
T |
 |
| Q |
648 |
at |
649 |
Q |
| |
|
|| |
|
|
| T |
24396452 |
at |
24396451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #164
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 606 - 654
Target Start/End: Complemental strand, 4444913 - 4444865
Alignment:
| Q |
606 |
cacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||| ||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
4444913 |
cacttgtgtgtgtgagtttataatgcctttgtcatttcgtctatctacc |
4444865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #165
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 550 - 654
Target Start/End: Original strand, 42483224 - 42483328
Alignment:
| Q |
550 |
aaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
|||||| ||||||||||||||||| | | ||| ||||||||||||| | |||| | |||||| ||| |||||||||| |||||||||||| ||||| |
|
|
| T |
42483224 |
aaatgctgaaattgttaggccggacgtcttgattggggttcgaaccctgacacctctatttatgtctgttagtttataataactttgccatttcatctat |
42483323 |
T |
 |
| Q |
650 |
ctacc |
654 |
Q |
| |
|
||||| |
|
|
| T |
42483324 |
ctacc |
42483328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #166
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 606 - 652
Target Start/End: Original strand, 40292651 - 40292697
Alignment:
| Q |
606 |
cacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
40292651 |
cacttatgtgtgtgagtttataatgattttgccatttcgtttatcta |
40292697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #167
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 528 - 652
Target Start/End: Original strand, 11408377 - 11408501
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcactta-tgtgtgtgagtttat |
626 |
Q |
| |
|
||||||||||||| || ||||||| || | |||||||||| || | | ||| | ||| ||||||| ||| |||||||||||| ||||||||||||||| |
|
|
| T |
11408377 |
aagtcctagctcaactagcaaaaa-tgtcaaaattgttagatcgaacgtcataatcggagttcgaatcccagtaccttcactttgtgtgtgtgagtttat |
11408475 |
T |
 |
| Q |
627 |
aatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||| |||||| | ||||||||||| |
|
|
| T |
11408476 |
gatggttttgccttctcgtctatcta |
11408501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #168
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 607 - 652
Target Start/End: Complemental strand, 36105171 - 36105126
Alignment:
| Q |
607 |
acttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||| |||||||| |
|
|
| T |
36105171 |
acttatgtgtgtgagtttataatagctttaccatttcatctatcta |
36105126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #169
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 612 - 653
Target Start/End: Complemental strand, 9362540 - 9362499
Alignment:
| Q |
612 |
tgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||||||||||| ||||| | |||||||||||||| |
|
|
| T |
9362540 |
tgtgtgtgagtttataatgactttgtcgtttcgtctatctac |
9362499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #170
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 549 - 610
Target Start/End: Complemental strand, 18692555 - 18692494
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcactt |
610 |
Q |
| |
|
|||||||| ||||| |||| ||| || ||||||||||| ||||||||||| ||||| ||||| |
|
|
| T |
18692555 |
aaaatgccaaaattattagaccgaataccatgaccgggattcgaaccccgatacctacactt |
18692494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #171
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 612 - 649
Target Start/End: Original strand, 34035412 - 34035449
Alignment:
| Q |
612 |
tgtgtgtgagtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
34035412 |
tgtgtgtgagtttataataggtttgccatttcgtctat |
34035449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #172
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 39916487 - 39916592
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||| |||||||| ||||||| || | ||| |||||||||||| || ||| ||||| ||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
39916487 |
aaaataccgaaattattaggccagacgttttgatcggggttcgaacgtcgacgcctccacttgtgtgtgtgagtttataatgactttatcatttcgtcta |
39916586 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
| |||| |
|
|
| T |
39916587 |
tatacc |
39916592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #173
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 612 - 649
Target Start/End: Complemental strand, 40529380 - 40529343
Alignment:
| Q |
612 |
tgtgtgtgagtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
40529380 |
tgtgtgtgagtttataatggctttgtcatttcatctat |
40529343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 114; Significance: 2e-57; HSPs: 161)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 2e-57
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 43676153 - 43676023
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43676153 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttgtgtgtgtgag |
43676056 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43676055 |
tttataatggctttgccatttcgtctatctacc |
43676023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 111; E-Value: 1e-55
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 19338308 - 19338177
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
19338308 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
19338211 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
19338210 |
gtttataatggctttgccatttcgtctatctacc |
19338177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 111; E-Value: 1e-55
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 48391954 - 48392085
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48391954 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccagggttcgaaccccggtacctccacttatgtgtgtga |
48392051 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
48392052 |
gtttataatggctttgccatttcgtctatctacc |
48392085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 107; E-Value: 3e-53
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 40958704 - 40958573
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| ||||||||| |
|
|
| T |
40958704 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaatcccggtacctccacttgtgtgtgtga |
40958607 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40958606 |
gtttataatggctttgccatttcgtctatctacc |
40958573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 106; E-Value: 1e-52
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 270451 - 270322
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
270451 |
atccagaagtcctagctcaactggcaaaaa-tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccact--tgtgtgtgag |
270355 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
270354 |
tttataatggctttgccatttcgtctatctacc |
270322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 104; E-Value: 2e-51
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 10635487 - 10635619
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
10635487 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
10635584 |
T |
 |
| Q |
621 |
g-tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10635585 |
gttttataatggctttgccatttcgtctatctacc |
10635619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 101; E-Value: 1e-49
Query Start/End: Original strand, 531 - 654
Target Start/End: Complemental strand, 20164193 - 20164072
Alignment:
| Q |
531 |
tcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatg |
630 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
20164193 |
tcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatg |
20164096 |
T |
 |
| Q |
631 |
gctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
20164095 |
gctttgccatttcgtctatctacc |
20164072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 101; E-Value: 1e-49
Query Start/End: Original strand, 526 - 654
Target Start/End: Original strand, 39606407 - 39606534
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||| |
|
|
| T |
39606407 |
agaagtcctagctcaactggcaaaa-atgccgatattgttaggccggatgccatgaccggggttcgaaccccgatacctccacttgtgtgtgtgagttta |
39606505 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39606506 |
taatggctttgccatttcgtctatctacc |
39606534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 99; E-Value: 2e-48
Query Start/End: Original strand, 520 - 641
Target Start/End: Original strand, 29005087 - 29005206
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
29005087 |
gtatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
29005184 |
T |
 |
| Q |
620 |
agtttataatggctttgccatt |
641 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
29005185 |
agtttataatggctttgccatt |
29005206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 98; E-Value: 8e-48
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 25821079 - 25820949
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||| | |||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |||||||||| |
|
|
| T |
25821079 |
atccagaagtcctagctcaactg--ataaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgag |
25820982 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
25820981 |
tttataatggctttgccatttcgtctatctacc |
25820949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 97; E-Value: 3e-47
Query Start/End: Original strand, 522 - 653
Target Start/End: Complemental strand, 43086600 - 43086471
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| ||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
43086600 |
atccataagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgag |
43086503 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |
|
|
| T |
43086502 |
tttataatggctttgtcatttcgtctatctac |
43086471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 48314166 - 48314296
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
48314166 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgaa |
48314263 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||| |
|
|
| T |
48314264 |
tttataatggctttaccattttgtctatctacc |
48314296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 93; E-Value: 8e-45
Query Start/End: Original strand, 521 - 652
Target Start/End: Complemental strand, 15906297 - 15906168
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| || |||||| |||||||||||||||||| |||||||||| | |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
15906297 |
tatccagaagtcctagctcaactagcaaaa--tgccgaaattgttaggccagatgccatgatcagggttcgaaccccggtacctccacttatgtgtgtga |
15906200 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |
|
|
| T |
15906199 |
gtttataatggctttaccatttcgtctatcta |
15906168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 93; E-Value: 8e-45
Query Start/End: Original strand, 521 - 652
Target Start/End: Complemental strand, 42631115 - 42630986
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
42631115 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgatcggggttcgaaccccgatacctccacttgtgtgtgtga |
42631018 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||| |
|
|
| T |
42631017 |
gtttataatgactttgtcatttcgtctatcta |
42630986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 93; E-Value: 8e-45
Query Start/End: Original strand, 519 - 654
Target Start/End: Original strand, 50248025 - 50248158
Alignment:
| Q |
519 |
agtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgt |
618 |
Q |
| |
|
|||||||||||||||||||||| ||| | |||||| |||||||||||||||||||| |||||||| ||||||||||||| ||||| ||||| ||||||| |
|
|
| T |
50248025 |
agtatccagaagtcctagctcaactg--ataaaatgtcgaaattgttaggccggatgtcatgaccgaggttcgaaccccgatacctccacttgtgtgtgt |
50248122 |
T |
 |
| Q |
619 |
gagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
50248123 |
gagtttataatggctttgccatttcgtctatctacc |
50248158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 92; E-Value: 3e-44
Query Start/End: Original strand, 520 - 654
Target Start/End: Original strand, 4126572 - 4126704
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
||||||||||||||||||||| ||| ||||| ||| ||||||||||||||||||||||||| | |||||||||||||||||||| ||||| |||||||| |
|
|
| T |
4126572 |
gtatccagaagtcctagctcaactgacaaaa--tgcggaaattgttaggccggatgccatgatcagggttcgaaccccggtacctccacttgtgtgtgtg |
4126669 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4126670 |
agtttataatgcctttgccatttcgtctatctacc |
4126704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 92; E-Value: 3e-44
Query Start/End: Original strand, 522 - 652
Target Start/End: Original strand, 5598300 - 5598428
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||| |||||| ||||||||| |||||||||||||||||| ||||| |||||||||| |
|
|
| T |
5598300 |
atccagaagtcctagctcaactgg--aaaaatgccgaaattgttaggtcggatgtcatgaccggagttcgaaccccggtacctccacttgtgtgtgtgag |
5598397 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |
|
|
| T |
5598398 |
tttataatggctttgtcatttcgtctatcta |
5598428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 92; E-Value: 3e-44
Query Start/End: Original strand, 521 - 651
Target Start/End: Original strand, 17068150 - 17068278
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| |||| |||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
17068150 |
tatccagaagtcctagctcaactggtaaaa--tgccgaaattgttaggccggatgccatgagcggggttcgaaccccggtacctccacttgtgtgtgtga |
17068247 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatct |
651 |
Q |
| |
|
||||||||||| |||| |||||||||||||| |
|
|
| T |
17068248 |
gtttataatggttttgtcatttcgtctatct |
17068278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 91; E-Value: 1e-43
Query Start/End: Original strand, 526 - 654
Target Start/End: Complemental strand, 13555849 - 13555722
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag-ttt |
624 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||| |||||||||||| |||||||||||||||||||||||||||| ||||| |||||||||| ||| |
|
|
| T |
13555849 |
agaagtcctagctcaactggcaaaa--tgccgaaattattaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttt |
13555752 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13555751 |
ataatggctttgccatttcgtctatctacc |
13555722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 525 - 649
Target Start/End: Original strand, 24119658 - 24119780
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |||| || ||||||||||||||||||| |
|
|
| T |
24119658 |
cagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgaccggggttcgaaccctggtatctccacttatgtgtgtgagttt |
24119755 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctat |
649 |
Q |
| |
|
||||| ||||||||||||||||||| |
|
|
| T |
24119756 |
ataatagctttgccatttcgtctat |
24119780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 549 - 654
Target Start/End: Complemental strand, 47429696 - 47429591
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
47429696 |
aaaatgccgaaattgttaggccggatgccatgatcggggttcgaatcccggtacctccacttatgtgtgtgagtttataatggctttgtcatttcgtcta |
47429597 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
47429596 |
tctacc |
47429591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 526 - 654
Target Start/End: Complemental strand, 48731881 - 48731755
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||||||||| ||| ||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
48731881 |
agaagtcctagctcaactgacaaaa--tgccgaaattgttaggccagatgccatgaccggggttcgaaccccggtacctctacttgtgtgtgtgagttta |
48731784 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||| ||||||||||||||||| |
|
|
| T |
48731783 |
taatggctttgtcatttcgtctatctacc |
48731755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 49948240 - 49948370
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| || ||||||||||||||||||||||||||||||| |||||||||| |||||| ||||| |||||||||| |
|
|
| T |
49948240 |
atccagaagtcctagctcaactggcaaaa--tgtcgaaattgttaggccggatgccatgaccgggattcgaaccccagtacctccacttgtgtgtgtgag |
49948337 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||| |
|
|
| T |
49948338 |
tttataatgactttgtcatttcgtctatctacc |
49948370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 525 - 654
Target Start/End: Original strand, 3315796 - 3315923
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||| |||||||||||||||||||||||| || ||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
3315796 |
cagaagtcctagctcaactggcaaaa--tgccgacattgttaggccggatgccatgaccaggattcgaaccccggtacctccacttgtgtgtgtgagttt |
3315893 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||| ||||||||||||| |||||||||| |
|
|
| T |
3315894 |
ataattgctttgccatttcatctatctacc |
3315923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 525 - 654
Target Start/End: Complemental strand, 8194088 - 8193961
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||| | ||| | ||||| |||||||||||||||| |||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
8194088 |
cagaagtcctagcttaactg--ataaaataccgaaattgttaggcctgatgccatgaccggggttcgaacccctgtacctccacttatgtgtgtgagttt |
8193991 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |
|
|
| T |
8193990 |
ataatgactttgccatttcgtctatctacc |
8193961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 21522315 - 21522446
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||| ||||||||||||||| ||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
21522315 |
tatctagaagtcctagctcaattggcaaag--tgccgaaattgttaggtcggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
21522412 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||| |
|
|
| T |
21522413 |
gtttataattgcttttccatttcgtctatctacc |
21522446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 32880709 - 32880578
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||| |||||||||| |||| ||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
32880709 |
tatctagaagtcctaactcaactggcaaaa--tgccgaaattgttaggccggatgccatgactggggttcgaaccccgctacctccacttgtgtgtgtga |
32880612 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||| |
|
|
| T |
32880611 |
gtttataatggctttgtcattccgtctatctacc |
32880578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 34010092 - 34010223
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||| ||||||| ||||||||| || |||||||||||||||||||||||||| ||||||| |||||||||||||| ||||| ||||||||| |
|
|
| T |
34010092 |
tatccagaagtcttagctcaactggcaaaa--tgtcgaaattgttaggccggatgccatgatcggggtttgaaccccggtacctccacttgtgtgtgtga |
34010189 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||| |
|
|
| T |
34010190 |
gtttataatggttttgccatttcatctatctacc |
34010223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 549 - 654
Target Start/End: Complemental strand, 18089872 - 18089768
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18089872 |
aaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgt-tgtgagtttataatggctttgccatttcgtcta |
18089774 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
18089773 |
tctacc |
18089768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 553 - 654
Target Start/End: Original strand, 35758303 - 35758404
Alignment:
| Q |
553 |
tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35758303 |
tgccgaaattgttaggctcgatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgagtttataatggctttaccatttcgtctatcta |
35758402 |
T |
 |
| Q |
653 |
cc |
654 |
Q |
| |
|
|| |
|
|
| T |
35758403 |
cc |
35758404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 49500860 - 49500990
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| ||||||||||||| ||||||||| ||||||||||||||||||||||| ||||| || ||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
49500860 |
atccacaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgatcgaggttcgaaccccggtacctccacttgtgtgtgtgag |
49500957 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||| |
|
|
| T |
49500958 |
tttataatagctttgtcatttcgtctatctacc |
49500990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 85; E-Value: 5e-40
Query Start/End: Original strand, 525 - 652
Target Start/End: Complemental strand, 41445156 - 41445031
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||| |||||||||||||||| ||||| ||| |||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
41445156 |
cagaagtcctagctcaactggcaaaa--tgccgacattgttaggccggatgtcatgatcggagttcgaaccccggtacctccacttgtgtgtgtgagttt |
41445059 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|| ||||||||||||||||||||||||| |
|
|
| T |
41445058 |
attatggctttgccatttcgtctatcta |
41445031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 13018071 - 13018202
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||| ||||||| ||||||| |||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| | ||||| | |
|
|
| T |
13018071 |
tatcaagaagtcttagctcaactggcaaag--tgccgaaattgttagaccggatgccatgaccggggttcgaaccccggtacctccacttgtatgtgtca |
13018168 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
13018169 |
gtttataatggctttgtcatttcgtctatctacc |
13018202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 533 - 654
Target Start/End: Complemental strand, 33845722 - 33845603
Alignment:
| Q |
533 |
ctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggc |
632 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||| ||||||| ||||||||| |||||||||||||||||| || || ||||||||||||||||||||| |
|
|
| T |
33845722 |
ctagctcaactggcaaaa--tgccgaaattgttagaccggatgtcatgaccggagttcgaaccccggtacctccaattgtgtgtgtgagtttataatggc |
33845625 |
T |
 |
| Q |
633 |
tttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
33845624 |
tttgccatttcgtctatctacc |
33845603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 533 - 654
Target Start/End: Original strand, 33948256 - 33948375
Alignment:
| Q |
533 |
ctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggc |
632 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||| ||||||| ||||||||| |||||||||||||||||| || || ||||||||||||||||||||| |
|
|
| T |
33948256 |
ctagctcaactggcaaaa--tgccgaaattgttagaccggatgtcatgaccggagttcgaaccccggtacctccaattgtgtgtgtgagtttataatggc |
33948353 |
T |
 |
| Q |
633 |
tttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
33948354 |
tttgccatttcgtctatctacc |
33948375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 528 - 652
Target Start/End: Complemental strand, 15331185 - 15331063
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttata |
627 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||| ||| |||||||||||| |
|
|
| T |
15331185 |
aagtcctagctcaactgg--aaaaatgccgaaattgttaggtcggatgccatgaccgaggttcgaaccccggtacctccacttgtgtatgtgagtttata |
15331088 |
T |
 |
| Q |
628 |
atggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||| ||||| ||||||||||||||| |
|
|
| T |
15331087 |
atgactttgtcatttcgtctatcta |
15331063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 551 - 652
Target Start/End: Complemental strand, 29803275 - 29803174
Alignment:
| Q |
551 |
aatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatc |
650 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||||||| | ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29803275 |
aatgccgaaattgttaggccagatgccatgatcggggttcgaaccccggtacatccacttgtgtgtgtgagtttataatggctttgccatttcgtctatc |
29803176 |
T |
 |
| Q |
651 |
ta |
652 |
Q |
| |
|
|| |
|
|
| T |
29803175 |
ta |
29803174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 520 - 652
Target Start/End: Original strand, 40685526 - 40685656
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
||||||||||||||||||||| ||||||||| || ||||||||||||| |||||| |||||||||||||||||| ||| ||||| || || |||||| | |
|
|
| T |
40685526 |
gtatccagaagtcctagctcaactggcaaaa--tgtcgaaattgttaggtcggatgtcatgaccggggttcgaactccgatacctccatttgtgtgtgag |
40685623 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
40685624 |
agtttataatggctttgccatttcgtctatcta |
40685656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 40809342 - 40809217
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
40809342 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgaccggggt-----ccccggtacctccacttgtgtgtgtgag |
40809250 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
40809249 |
tttataatggctttgcaatttcgtctatctacc |
40809217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 23225420 - 23225289
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| ||||||||||||| |||| ||||| || | ||||||||||| ||||||||||||| ||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
23225420 |
atccacaagtcctagctcaactggtaaaaa-tgtcaaaattgttaggtcggatgccatgacaggggttcgaaccccggtacctccacttgtgtgtgtgag |
23225322 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||| |
|
|
| T |
23225321 |
tttataatggttttgccatttcgtctatatacc |
23225289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 15104042 - 15104174
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||| ||||||||||||||| ||| ||||| |||| |||||||||||||||||| ||||| |||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
15104042 |
tatctagaagtcctagctcaactgacaaaa--tgccaaaattgttaggccggatgtcatgatcggggttcgaaccccgatacctctacttatgtgtgtga |
15104139 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttc-gtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
15104140 |
gtttataatggctttgccatttctgtctatctacc |
15104174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 528 - 650
Target Start/End: Complemental strand, 10430463 - 10430342
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttata |
627 |
Q |
| |
|
||||||||||||| ||| |||||| |||||||||||||||||||||||| ||||| ||||||||||||| ||||||| ||||| |||||||||||||||| |
|
|
| T |
10430463 |
aagtcctagctcaactgacaaaaa-tgccgaaattgttaggccggatgcaatgactggggttcgaaccctggtacctccacttgtgtgtgtgagtttata |
10430365 |
T |
 |
| Q |
628 |
atggctttgccatttcgtctatc |
650 |
Q |
| |
|
||| |||||||||||||| |||| |
|
|
| T |
10430364 |
atgcctttgccatttcgtttatc |
10430342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 78; E-Value: 7e-36
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 27078572 - 27078677
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| |||| ||||||||||||| || |
|
|
| T |
27078572 |
aaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttatgtgtgtgagtttatgatggttttgccatttcgttta |
27078671 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
| |||| |
|
|
| T |
27078672 |
tttacc |
27078677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 518 - 653
Target Start/End: Original strand, 12282610 - 12282742
Alignment:
| Q |
518 |
tagtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtg |
617 |
Q |
| |
|
||||||| ||||||||||| ||| ||| | ||| || |||||||||||||| |||||||||||||||||||||||| | ||||||| |||||||||||| |
|
|
| T |
12282610 |
tagtatctagaagtcctagttcaactg--ataaagtgtcgaaattgttaggctggatgccatgaccggggttcgaactc-ggtacctccacttatgtgtg |
12282706 |
T |
 |
| Q |
618 |
tgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12282707 |
taagtttataatggctttgccatttcgtctatctac |
12282742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 520 - 654
Target Start/End: Original strand, 11403166 - 11403298
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
|||| |||||||||||||||| |||| |||| |||||||||||||||| |||||||||||| |||||||||||||||||||| | || || |||||||| |
|
|
| T |
11403166 |
gtattcagaagtcctagctcaactgggaaaa--tgccgaaattgttaggtcggatgccatgatcggggttcgaaccccggtacatccatttgtgtgtgtg |
11403263 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||| |||||| |||||| |||||||||| |
|
|
| T |
11403264 |
agtttataatagctttgtcatttcttctatctacc |
11403298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 549 - 644
Target Start/End: Original strand, 18216368 - 18216463
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcg |
644 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||| ||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18216368 |
aaaatgccgaaattgttaggccggatgccatgatcggggttcaaactccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcg |
18216463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 25083249 - 25083119
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgt-- |
618 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||| |||||||| |||||||||||||| |||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
25083249 |
tatccagaagtcctagctcaactggcaaaa--tgctgaaattgt---gccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtga |
25083155 |
T |
 |
| Q |
619 |
gagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
25083154 |
gagtttataatggctttgtcatttcgtctatctacc |
25083119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 36586275 - 36586378
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||| |||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
36586275 |
aaaatgtcgaaattgttaggccggatgccgtgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgtcatttcatcta |
36586374 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
36586375 |
tcta |
36586378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 520 - 654
Target Start/End: Original strand, 18475106 - 18475235
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
||||||||||||||||||||| ||||||||| | |||| |||||||||||||||||||||| |||||||||||||| |||||| | ||||||||| |
|
|
| T |
18475106 |
gtatccagaagtcctagctcaactggcaaaata--ccgacattgttaggccggatgccatgatcggggttcgaaccctggtaccc---catatgtgtgta |
18475200 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18475201 |
agtttataatggctttgccattttgtctatctacc |
18475235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 73; E-Value: 7e-33
Query Start/End: Original strand, 522 - 653
Target Start/End: Complemental strand, 26261422 - 26261293
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| ||||||||||||| |||| ||||||||||||||||||||||||||| |||||| ||||||||||| |||||||||| ||||| ||||||| | |
|
|
| T |
26261422 |
atccacaagtcctagctcaactgg--aaaaatgccgaaattgttaggccggataccatgatcggggttcgaatcccggtacctccacttgtgtgtgtaaa |
26261325 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||| ||||| ||| |||||||||||| |
|
|
| T |
26261324 |
tttataatgtctttgtcatctcgtctatctac |
26261293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 559 - 654
Target Start/End: Original strand, 300950 - 301045
Alignment:
| Q |
559 |
aattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||| |||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
300950 |
aattgttaggccggatgctatgaccggggttcaaacccgagtaccttcacttgtatgtgtgagtttataatggctttgccatttcgtctatctacc |
301045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 549 - 652
Target Start/End: Complemental strand, 13980410 - 13980307
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| ||||||||||||| ||||| ||||| ||||||||||| |||||||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13980410 |
aaaatgtcgaaattgttaggtcggatatcatgatcggggttcgaatcccggtacctccacttatgtgtgtgagtttataatagctttgccatttcgtcta |
13980311 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
13980310 |
tcta |
13980307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 548 - 654
Target Start/End: Original strand, 1576397 - 1576503
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||||| |||||||| | ||||||||||||||||||||||||| ||| ||||| |||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
1576397 |
aaaaatgccaaaattgtttgatcggatgccatgaccggggttcgaactccgttacctccacttatgtgtgtgagtttataatggttttgtcatttcgtct |
1576496 |
T |
 |
| Q |
648 |
atctacc |
654 |
Q |
| |
|
||||||| |
|
|
| T |
1576497 |
atctacc |
1576503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 556 - 654
Target Start/End: Complemental strand, 13048904 - 13048806
Alignment:
| Q |
556 |
cgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||| ||||| ||| |||||||||||||||||| || ||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
13048904 |
cgaaattgttaggccggatgtcatgatcggagttcgaaccccggtacctccatttatgtgtgtgagtttataatggttttgccattccgtctatctacc |
13048806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 556 - 654
Target Start/End: Complemental strand, 13053901 - 13053803
Alignment:
| Q |
556 |
cgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||| ||||| ||| |||||||||||||||||| || ||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
13053901 |
cgaaattgttaggccggatgtcatgatcggagttcgaaccccggtacctccatttatgtgtgtgagtttataatggttttgccattccgtctatctacc |
13053803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 526 - 652
Target Start/End: Complemental strand, 50145258 - 50145133
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||||||||| | |||||||| || | | |||||||||||||||| |||||| ||| ||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
50145258 |
agaagtcctagctcaaccggcaaaaa-tgtcaatattgttaggccggatgtcatgactgggattcgaaccccgataccttcacttgtgtgtgtgagttta |
50145160 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||| ||||| ||||||||||||||| |
|
|
| T |
50145159 |
taatgactttgtcatttcgtctatcta |
50145133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 525 - 645
Target Start/End: Complemental strand, 40962828 - 40962710
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| ||| ||||| |||| ||||| |||||| ||||||||||| |||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
40962828 |
cagaagtcctagctcaactgacaaaa--tgccaaaattattaggctggatgccatgatcggggttcgaaccccgatacctccacttatgtgtgtgagttt |
40962731 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgt |
645 |
Q |
| |
|
||||||| ||||| ||||||| |
|
|
| T |
40962730 |
ataatggttttgctatttcgt |
40962710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 521 - 640
Target Start/End: Complemental strand, 39787780 - 39787663
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||| ||||||||||||| |||| |||| || |||||||||||| ||| |||||||||||||||||||||| ||||||||| ||||||| ||||||| |
|
|
| T |
39787780 |
tatccacaagtcctagctcaactggtaaaa--tgtcgaaattgttagaccgaatgccatgaccggggttcgaactccggtacctccacttatatgtgtga |
39787683 |
T |
 |
| Q |
621 |
gtttataatggctttgccat |
640 |
Q |
| |
|
|||||||||| ||||||||| |
|
|
| T |
39787682 |
gtttataatgactttgccat |
39787663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 556 - 652
Target Start/End: Complemental strand, 45007788 - 45007693
Alignment:
| Q |
556 |
cgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||||||| |||||| | ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45007788 |
cgaaattgttaggccggatgtcatgaccgaggttcgaaccccagtacctcc-cttatgtgtgtgagtttataatggctttgtcatttcgtctatcta |
45007693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 43025884 - 43026020
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-----ttatgtg |
615 |
Q |
| |
|
|||||||||||||||| ||| ||| ||||| || |||||||||||||||||||||||||||| |||||||||| | |||||| ||| || |||| |
|
|
| T |
43025884 |
tatccagaagtcctagttcaactgacaaaatat--cgaaattgttaggccggatgccatgacctgggttcgaacttcagtacctccacttgtgttgtgtg |
43025981 |
T |
 |
| Q |
616 |
tgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43025982 |
tgtgagtttataatggctttgccatttcgtctatctacc |
43026020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 552 - 654
Target Start/End: Complemental strand, 16084334 - 16084233
Alignment:
| Q |
552 |
atgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatct |
651 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |||||||| ||||| |||||||||||| | |
|
|
| T |
16084334 |
atgccgaaattgttaggccggatgccatgatcggggtttgaaccccaataccttcacttatgtgtgtgag-ttataatgtctttgtcatttcgtctattt |
16084236 |
T |
 |
| Q |
652 |
acc |
654 |
Q |
| |
|
||| |
|
|
| T |
16084235 |
acc |
16084233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 19279982 - 19279851
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| |||| |||| |||||||||||||||| ||||| |||||| ||||| |||||| |||| || ||||||||||| ||| |
|
|
| T |
19279982 |
tatccagaagtcctagctcaactggtaaaa--tgccgaaattgttaggtcggataccatgattagggtttgaaccctggtatctccacttatgtgtatga |
19279885 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||| |
|
|
| T |
19279884 |
gtttataatggctttgtcattttgtctatctacc |
19279851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 550 - 653
Target Start/End: Original strand, 48302309 - 48302414
Alignment:
| Q |
550 |
aaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttata--atggctttgccatttcgtct |
647 |
Q |
| |
|
||||||||||||||||| |||| || |||||||||||||||||| ||| |||||| |||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
48302309 |
aaatgccgaaattgttaagccgaataccatgaccggggttcgaatcccagtacctccacttatgtgtgtgagtttataatatggctttgtcatttcgtct |
48302408 |
T |
 |
| Q |
648 |
atctac |
653 |
Q |
| |
|
|||||| |
|
|
| T |
48302409 |
atctac |
48302414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 522 - 652
Target Start/End: Original strand, 49632553 - 49632682
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| ||||||||| ||| |||| |||| |||||||||||||||||| ||||| |||||||| ||||||||||||| ||||| ||||| |||||||||| |
|
|
| T |
49632553 |
atccataagtcctagttcaactggtaaaa-atgccgaaattgttaggctggatgtcatgaccgaggttcgaaccccgatacctccacttgtgtgtgtgag |
49632651 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||| ||| ||||||||||||||| |
|
|
| T |
49632652 |
tttataatgattttatcatttcgtctatcta |
49632682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 549 - 650
Target Start/End: Original strand, 45788647 - 45788748
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||| |||||||||||| |||| ||||||||| |||||||||||||||| ||||| ||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45788647 |
aaaataccgaaattgttaagccgaatgccatgatcggggttcgaaccccgatacctccacttctgtgtgtgagtttataatggctttatcatttcgtcta |
45788746 |
T |
 |
| Q |
649 |
tc |
650 |
Q |
| |
|
|| |
|
|
| T |
45788747 |
tc |
45788748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 550 - 654
Target Start/End: Original strand, 27856022 - 27856126
Alignment:
| Q |
550 |
aaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
||||||||||||||||||||| |||| ||||| ||||||||||| |||||||| | ||||| ||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
27856022 |
aaatgccgaaattgttaggccagatgtcatgatcggggttcgaatcccggtacttccacttgtgtgtgtgagtttataatgactttttcatttcgtctat |
27856121 |
T |
 |
| Q |
650 |
ctacc |
654 |
Q |
| |
|
||||| |
|
|
| T |
27856122 |
ctacc |
27856126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 521 - 652
Target Start/End: Original strand, 32533825 - 32533954
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||||| |||| ||| ||||||||| |||| |||||||||||||| ||||||| | ||| |||||||| | ||||||| ||||||||||||||| |
|
|
| T |
32533825 |
tatccagaagttctagttcaactggcaaaa--tgccaaaattgttaggccgaatgccataatcggagttcgaactctggtacctccacttatgtgtgtga |
32533922 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||| | |||| ||||||||||||||| |
|
|
| T |
32533923 |
gtttataatagttttgtcatttcgtctatcta |
32533954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 526 - 652
Target Start/End: Original strand, 39467027 - 39467149
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||||||||| ||||||||| || ||||||||||||| ||||| |||| ||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
39467027 |
agaagtcctagctcaactggcaaaa--tggtaaaattgttaggccagatgctatgatcggggttcgaaccccggtaccttcact--tgtgtgtaagttta |
39467122 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||| ||| |||||||||||||||| |
|
|
| T |
39467123 |
taatggtttttccatttcgtctatcta |
39467149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 523 - 653
Target Start/End: Original strand, 2112747 - 2112875
Alignment:
| Q |
523 |
tccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagt |
622 |
Q |
| |
|
|||| ||||||||||||| || |||||| || ||||| |||||| |||| | |||||||||||||||||||| |||||| ||||| ||||||||||| |
|
|
| T |
2112747 |
tccacaagtcctagctcaactagcaaaa--tgatgaaatcgttaggtcggacgtcatgaccggggttcgaacccatgtacctccacttgtgtgtgtgagt |
2112844 |
T |
 |
| Q |
623 |
ttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |
|
|
| T |
2112845 |
ttataatggctttgtcatttcgtctatctac |
2112875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 520 - 654
Target Start/End: Complemental strand, 15324584 - 15324453
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
||||||| ||||| ||||||| ||| ||||| |||||||||| ||||| ||||| || ||| ||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
15324584 |
gtatccacaagtcatagctcaactgacaaaa--tgccgaaattattaggtcggatatca-gactggggttcgaaccccggtacctccacttgtgtgtgtg |
15324488 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||| |
|
|
| T |
15324487 |
agtttatgatggttttgccatttcgtctatctacc |
15324453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 36018902 - 36019005
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||| |||||||| || || | ||| | ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36018902 |
aaaatgtcgaaattgttaggccggatgtcatgatcggggttcaaatcctgatacttccacttgtgtgtgtgagtttataatggctttgccatttcgtcta |
36019001 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
36019002 |
tcta |
36019005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 548 - 654
Target Start/End: Original strand, 236593 - 236698
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||| |||||||||||||||||| | |||||||||||||||||||||||||||||||||| | ||||||||||||| ||| ||||| ||| | |||| |
|
|
| T |
236593 |
aaaaatgtcgaaattgttaggccggacgtcatgaccggggttcgaaccccggtaccttcactt-tatgtgtgagtttatgatgactttgtcatcttgtct |
236691 |
T |
 |
| Q |
648 |
atctacc |
654 |
Q |
| |
|
||||||| |
|
|
| T |
236692 |
atctacc |
236698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 8214622 - 8214750
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| |||| |||| || |||||||||||||||||| ||||||||||||||| ||||||| ||||| ||| ||||| |||| |
|
|
| T |
8214622 |
atccagaagtcctagctcaactggaaaaatat--cgaaattgttaggccggaccccatgaccggggttcaaaccccgatacctccac--gtgtgtatgag |
8214717 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||| |
|
|
| T |
8214718 |
tttataatggctttaccatttcgtccatctacc |
8214750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 526 - 654
Target Start/End: Complemental strand, 15952957 - 15952830
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag-ttt |
624 |
Q |
| |
|
||||||| ||||||| ||||||||| |||||||||||||||| |||||| |||| |||||||||||| ||||||||| ||||| |||||||||| ||| |
|
|
| T |
15952957 |
agaagtcgtagctcaactggcaaaa--tgccgaaattgttaggtcggatgttatgatcggggttcgaactccggtacctccacttgtgtgtgtgagtttt |
15952860 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||| | |||| ||||||||||||||||| |
|
|
| T |
15952859 |
ataatagttttgtcatttcgtctatctacc |
15952830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 29510781 - 29510650
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||||||||| |||| ||| ||||| |||| |||||||||| |||||| ||||||||||||||||||| ||||| | ||||| ||||||||| |
|
|
| T |
29510781 |
tatccagaagtcctaactcaactgtcaaaa--tgccaaaattgttagatcggatgtcatgaccggggttcgaaccttggtacttccacttgtgtgtgtga |
29510684 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||| |||| |||||| ||||||||||| |
|
|
| T |
29510683 |
gtttataatgactttaccattttgtctatctacc |
29510650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 525 - 654
Target Start/End: Complemental strand, 39522884 - 39522757
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
||||||||||| |||| ||||||||| ||| ||||||||||||||||||||||| | |||||||||||| ||||||| | ||| | ||| ||||||||| |
|
|
| T |
39522884 |
cagaagtcctaactcaactggcaaaa--tgcagaaattgttaggccggatgccattatcggggttcgaactccggtacatccacctgtgtatgtgagttt |
39522787 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||| |||||||||| |||||||||| |
|
|
| T |
39522786 |
ataatggttttgccattttatctatctacc |
39522757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 528 - 652
Target Start/End: Original strand, 41651078 - 41651201
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcactt-atgtgtgtgagtttat |
626 |
Q |
| |
|
||||||||||||| |||| |||| |||||||||||||||| ||| | ||||| ||||||||||| ||||||||||||| || |||||||||||||||| |
|
|
| T |
41651078 |
aagtcctagctcaactggtaaaa--tgccgaaattgttaggttggacgtcatgatcggggttcgaatcccggtaccttcattttatgtgtgtgagtttat |
41651175 |
T |
 |
| Q |
627 |
aatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||| |||| ||||||||||||||| |
|
|
| T |
41651176 |
aatggttttgtcatttcgtctatcta |
41651201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 555 - 637
Target Start/End: Complemental strand, 52155356 - 52155274
Alignment:
| Q |
555 |
ccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgc |
637 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||| |||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
52155356 |
ccgatattgttaggctggatgccatgaccggggttcgaaccccagtacctccacttgtgtgtgtgagtttataatggctttgc |
52155274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 549 - 654
Target Start/End: Complemental strand, 43500247 - 43500142
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| ||||||||||||| ||||||| |||| |||||||| ||| | ||||||| || || ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43500247 |
aaaatgtcgaaattgttaggtcggatgctatgatcggggttcaaactctggtacctccatttgtgtatgtgagtttataatggctttgccatttcgtcta |
43500148 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
43500147 |
tctacc |
43500142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 61; E-Value: 1e-25
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 11786127 - 11786231
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag-tttataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||| ||||||||||||||||||| |||| | ||||||| ||||||||||||| ||||| |||||||||| ||||||||| ||||| |||||||||| |
|
|
| T |
11786127 |
aaaatgctgaaattgttaggccggatgtcatggctggggttcaaaccccggtacctccacttgtgtgtgtgagttttataatgactttgtcatttcgtct |
11786226 |
T |
 |
| Q |
648 |
atcta |
652 |
Q |
| |
|
||||| |
|
|
| T |
11786227 |
atcta |
11786231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 61; E-Value: 1e-25
Query Start/End: Original strand, 558 - 654
Target Start/End: Complemental strand, 44623113 - 44623017
Alignment:
| Q |
558 |
aaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| |||||||| ||||| |||||||||||| |||||| | ||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44623113 |
aaattgttaagccggatgtcatgatcggggttcgaacttcggtacttccacttatgtatgtgagtttataatggctttgtcatttcgtctatctacc |
44623017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 61; E-Value: 1e-25
Query Start/End: Original strand, 557 - 653
Target Start/End: Complemental strand, 52492777 - 52492681
Alignment:
| Q |
557 |
gaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||| |||||||| ||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
52492777 |
gaaattgttaggccggatgtcatgattggggttcgaaccccggtttcttcacttgtgtgtgtgagtttataatgactttatcatttcgtctatctac |
52492681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 524 - 654
Target Start/End: Original strand, 29511109 - 29511237
Alignment:
| Q |
524 |
ccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtt |
623 |
Q |
| |
|
||||||||||||||||| ||| |||| || |||||||||||||||| ||| |||||||||||||||||||||| ||||| || |||||||| |||||| |
|
|
| T |
29511109 |
ccagaagtcctagctcaattggtaaaa--tgacgaaattgttaggccgaatgtcatgaccggggttcgaaccccgatacctccatttatgtgtatgagtt |
29511206 |
T |
 |
| Q |
624 |
tataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||| ||||| |||| ||||||||||| |
|
|
| T |
29511207 |
tataataattttgctattttgtctatctacc |
29511237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 549 - 652
Target Start/End: Complemental strand, 46561339 - 46561236
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||| |||||||||||| ||| ||||| ||||| |||||||||||||||||| ||||| |||||||||| |
|
|
| T |
46561339 |
aaaatgccaaaattgttagtccggatgccatgatcggggttcgaactccgttacctccacttgcgtgtgtgagtttataatgattttgcaatttcgtcta |
46561240 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
46561239 |
tcta |
46561236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 522 - 642
Target Start/End: Original strand, 5322591 - 5322709
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
|||||||||| |||||||| ||| ||||| ||| ||||||||||||| |||| |||||||||||||||||||||| ||| ||||||| ||||||| || |
|
|
| T |
5322591 |
atccagaagttctagctcaactgacaaaa--tgctgaaattgttaggctggatatcatgaccggggttcgaaccccgatacgttcacttgtgtgtgtaag |
5322688 |
T |
 |
| Q |
622 |
tttataatggctttgccattt |
642 |
Q |
| |
|
| |||||||||||||| |||| |
|
|
| T |
5322689 |
tgtataatggctttgcaattt |
5322709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 528 - 652
Target Start/End: Complemental strand, 7204632 - 7204508
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttat |
626 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||||||| | |||||||||||||||||||||| ||||| ||| || ||| ||||||||||| |
|
|
| T |
7204632 |
aagtcctagctcaactggcaaaaa-tgccgaaattgttaggccgaacatcatgaccggggttcgaaccccgatacctccactttgtgtatgtgagtttat |
7204534 |
T |
 |
| Q |
627 |
aatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||| || |||||||| |
|
|
| T |
7204533 |
ggtggctttgccatgtcttctatcta |
7204508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 556 - 649
Target Start/End: Complemental strand, 23809981 - 23809888
Alignment:
| Q |
556 |
cgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
|||||||||||||||||||| ||||| ||| |||||||| ||| ||||| ||||||||||||||||||||||||| ||||| ||||| |||||| |
|
|
| T |
23809981 |
cgaaattgttaggccggatgtcatgatcggagttcgaactccgatacctccacttatgtgtgtgagtttataatgactttgtcattttgtctat |
23809888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 528 - 652
Target Start/End: Complemental strand, 38886512 - 38886390
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttata |
627 |
Q |
| |
|
||||||||||||| |||| |||| | |||||||||||||||| || ||| |||| |||| ||||||||| | ||| ||||| ||||||||| |||||| |
|
|
| T |
38886512 |
aagtcctagctcaactggtaaaata--ccgaaattgttaggccagacgccttgacggggggtcgaacccccgcccctccacttgtgtgtgtgaatttata |
38886415 |
T |
 |
| Q |
628 |
atggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
38886414 |
atggctttgccatttcgtctatcta |
38886390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 549 - 649
Target Start/End: Original strand, 40241512 - 40241610
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||| ||||||||| |||||||| |||| ||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
40241512 |
aaaatgtcgaaattgttaggccggatatcatgaccggagttcgaacctcggtacctccact--tgtgtgtgagtttataatgactttgctatttcgtcta |
40241609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 40503596 - 40503726
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
|||||||||| |||||||| ||| ||||| || ||||||||||||||||||| ||||| | |||||||| || |||| || |||||||||||||||| |
|
|
| T |
40503596 |
atccagaagttctagctcaactgacaaaa--tgttgaaattgttaggccggatgtcatgatcaaggttcgaatcctggtaactccacttatgtgtgtgag |
40503693 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
| ||||||||||| || |||||||||||||||| |
|
|
| T |
40503694 |
tatataatggcttcgctatttcgtctatctacc |
40503726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 549 - 653
Target Start/End: Original strand, 5511807 - 5511911
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| |||||||||||||| | ||||||||| ||||||||||| |||||||| || |||||| |||||||||||||||| |||| ||||||||||| |
|
|
| T |
5511807 |
aaaatgtcgaaattgttaggctgaatgccatgattggggttcgaacttcggtacctccatttatgtatgtgagtttataatggttttgtcatttcgtcta |
5511906 |
T |
 |
| Q |
649 |
tctac |
653 |
Q |
| |
|
||||| |
|
|
| T |
5511907 |
tctac |
5511911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 526 - 654
Target Start/End: Original strand, 5790061 - 5790197
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttc----------acttatgtg |
615 |
Q |
| |
|
||||||||||||| | ||||||||| ||||||||||||||||||||||| ||||||||||||||||| |||| ||||| | |||| ||| |
|
|
| T |
5790061 |
agaagtcctagcttaactggcaaaa--tgccgaaattgttaggccggatgtcatgaccggggttcgaatcccgatacctccacttgtgtatacttgtgta |
5790158 |
T |
 |
| Q |
616 |
tgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5790159 |
tgtaagtttataatggctttgccatttcgtctatctacc |
5790197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 549 - 641
Target Start/End: Original strand, 9705551 - 9705642
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatt |
641 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||||||||||||||| || ||||| |||||||||| |||||||| |||||||||| |
|
|
| T |
9705551 |
aaaatgccaaaattgttaggccggatgccatgactggggttcgaaccccggtttctccacttgtgtgtgtgag-ttataatgcctttgccatt |
9705642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 522 - 629
Target Start/End: Complemental strand, 35010718 - 35010613
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| || |||||| ||||||||||||||||| ||||||||||| || |||||||||||| ||||| ||||||| | |||||| |
|
|
| T |
35010718 |
atccagaagtcctagctcaactagcaaaa--tgccgaaattgttaggctggatgccatgattggagttcgaaccccgatacctccacttatatatgtgag |
35010621 |
T |
 |
| Q |
622 |
tttataat |
629 |
Q |
| |
|
|||||||| |
|
|
| T |
35010620 |
tttataat |
35010613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 525 - 649
Target Start/End: Complemental strand, 21897807 - 21897687
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
||||| |||||||||| ||| ||||| || |||||||||||||| |||||| |||| |||||||||||| ||||||||| |||| ||| | ||||||| |
|
|
| T |
21897807 |
cagaaatcctagctcaactgacaaaa--tgtcgaaattgttaggctggatgctatgatcggggttcgaactccggtacctccact--tgtttatgagttt |
21897712 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctat |
649 |
Q |
| |
|
||||||||||||||||||| ||||| |
|
|
| T |
21897711 |
ataatggctttgccatttcatctat |
21897687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 549 - 649
Target Start/End: Original strand, 46850988 - 46851086
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||| | |||||||||| |||||| || |||| |||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
46850988 |
aaaatgtcgaaattgttaggtcggatgccatgatccgggttcgaactccggtatctccact--tgtgtgtgagtttataatggttttgccatttcatcta |
46851085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 521 - 652
Target Start/End: Original strand, 6669305 - 6669433
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||| ||||||| || | ||||||| ||||| |||| |||||| |||||||| | ||||||||||||||||| ||||||||||||||| |
|
|
| T |
6669305 |
tatccagaagtcttagctcaattg--ataaaatgctaaaattattagaccggatatcatgaccgag-ttcgaaccccggtacctccacttatgtgtgtga |
6669401 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||| |||||| | |||||| |
|
|
| T |
6669402 |
gtttataatggctttgtcatttcatttatcta |
6669433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 548 - 652
Target Start/End: Complemental strand, 40326825 - 40326722
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||| ||| |||||||||||| |||||||| || ||||||||| |||||||||| |||| ||||||||| |
|
|
| T |
40326825 |
aaaaatgccgaaattgttaggc-ggatgttatgatcggagttcgaaccccgataccttcatttgtgtgtgtgaatttataatggttttgtaatttcgtct |
40326727 |
T |
 |
| Q |
648 |
atcta |
652 |
Q |
| |
|
||||| |
|
|
| T |
40326726 |
atcta |
40326722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 548 - 652
Target Start/End: Complemental strand, 45458760 - 45458657
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
|||||| |||||||| ||| ||||||||| ||||| ||||||||||||||| ||||| || ||||||||||| ||||| ||||| |||| |||||||||| |
|
|
| T |
45458760 |
aaaaataccgaaatttttaagccggatgctatgacaggggttcgaaccccgatacctccatttatgtgtgtgggtttacaatgg-tttgtcatttcgtct |
45458662 |
T |
 |
| Q |
648 |
atcta |
652 |
Q |
| |
|
||||| |
|
|
| T |
45458661 |
atcta |
45458657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 549 - 652
Target Start/End: Complemental strand, 24254514 - 24254412
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| |||||||||||||| |||| ||||| ||||||||||||||| |||| | ||||| ||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
24254514 |
aaaatgtcgaaattgttaggctagatgtcatgatcggggttcgaaccccagtac-tccacttgtgtgtgtgagtttataatgactttatcatttcgtcta |
24254416 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
24254415 |
tcta |
24254412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 556 - 646
Target Start/End: Original strand, 11942562 - 11942652
Alignment:
| Q |
556 |
cgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
|||||||||||||||| || | |||| |||||||||||| |||||| || ||||| |||||| ||||||||||||| |||||||||||||| |
|
|
| T |
11942562 |
cgaaattgttaggccgaatactatgatcggggttcgaactccggtatctccacttgtgtgtgagagtttataatggttttgccatttcgtc |
11942652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 520 - 585
Target Start/End: Original strand, 28999371 - 28999434
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccgg |
585 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28999371 |
gtatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccgg |
28999434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 48474744 - 48474850
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgcca-tttcgtct |
647 |
Q |
| |
|
|||||| |||||||| |||| |||||||||||| ||||||||| |||||| ||| ||||||| |||||||||||||||||||||| || |||||||| |
|
|
| T |
48474744 |
aaaatgtcgaaattgataggttggatgccatgactagggttcgaatcccggttcctccacttatatgtgtgagtttataatggctttatcattttcgtct |
48474843 |
T |
 |
| Q |
648 |
atctacc |
654 |
Q |
| |
|
||||||| |
|
|
| T |
48474844 |
atctacc |
48474850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 528 - 652
Target Start/End: Original strand, 16689091 - 16689213
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttata |
627 |
Q |
| |
|
||||||||||||| ||||||||| || ||||||| ||||| |||| | | ||| ||||||||||||||| |||| |||| |||||||||||||||| |
|
|
| T |
16689091 |
aagtcctagctcaactggcaaaatat--cgaaatttttaggtcggacgtcttgatcggggttcgaaccccaacacctcaacttgtgtgtgtgagtttata |
16689188 |
T |
 |
| Q |
628 |
atggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||| |||||||| |||||| |
|
|
| T |
16689189 |
atggctttgtcatttcgtgtatcta |
16689213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 556 - 652
Target Start/End: Original strand, 13948135 - 13948230
Alignment:
| Q |
556 |
cgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||| | ||||| |||| ||||||||||||||||| ||| ||||| | |||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
13948135 |
cgaaattgttaggtcagatgctatgatcggggttcgaaccccggcgcctccacttgt-tgtgtgagtttataatggttttgtcatttcgtctatcta |
13948230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 528 - 654
Target Start/End: Complemental strand, 44836242 - 44836116
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttat |
626 |
Q |
| |
|
|||||||||| || |||||||||| | | ||||||||||| |||| | ||||| ||||||||||||||||||| || ||| |||| ||||||||||||| |
|
|
| T |
44836242 |
aagtcctagcacaactggcaaaaa-tatcaaaattgttaggtcggacgtcatgatcggggttcgaaccccggtatctccactttatatgtgtgagtttat |
44836144 |
T |
 |
| Q |
627 |
aatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| ||| || |||||||||| |
|
|
| T |
44836143 |
gatggctttgtcatctcatctatctacc |
44836116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 556 - 654
Target Start/End: Original strand, 7286566 - 7286664
Alignment:
| Q |
556 |
cgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||| ||| || | |||| |||| ||| ||||||| ||| ||||||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
7286566 |
cgaaattgttagaccgaatacaatgatcgggcttcaaaccccgatactttcacttatgtgtgtgagtttataatggctttgttattttatctatctacc |
7286664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 583 - 653
Target Start/End: Complemental strand, 12500605 - 12500535
Alignment:
| Q |
583 |
cggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||| ||| ||||| ||||||||||| |||||| |||||||||||| |||||||||||||||| |
|
|
| T |
12500605 |
cggggttcgaactccgatacctccacttatgtgtatgagttcataatggctttgtcatttcgtctatctac |
12500535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 548 - 654
Target Start/End: Complemental strand, 26763449 - 26763343
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||||||||||||||||| |||| | || |||||||||||||||| | || ||| | ||| ||||||||||||||| || |||||| ||| ||| || |
|
|
| T |
26763449 |
aaaaatgccgaaattgttaggtcggacgtcacgaccggggttcgaacctctgtgcctccgcttgtgtgtgtgagtttatgatagctttgtcatctcgcct |
26763350 |
T |
 |
| Q |
648 |
atctacc |
654 |
Q |
| |
|
||||||| |
|
|
| T |
26763349 |
atctacc |
26763343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 548 - 653
Target Start/End: Complemental strand, 37186922 - 37186816
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
||||||||||||||||||| |||||| | ||||||| |||||||||| | ||||||| ||| || ||||| ||||||||| ||||||||| ||| || || |
|
|
| T |
37186922 |
aaaaatgccgaaattgttaagccggacgtcatgaccagggttcgaactctggtacctccactttgtgtgtttgagtttatgatggctttgtcatctcttc |
37186823 |
T |
 |
| Q |
647 |
tatctac |
653 |
Q |
| |
|
||||||| |
|
|
| T |
37186822 |
tatctac |
37186816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 577 - 635
Target Start/End: Complemental strand, 51263889 - 51263831
Alignment:
| Q |
577 |
catgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggcttt |
635 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
51263889 |
catgaccggggttcgaactccggtacctccacttatgtgtgtgagtttataatgacttt |
51263831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 549 - 653
Target Start/End: Complemental strand, 2208999 - 2208897
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||||||||||||||| |||||| |||||| | | |||||| |||| ||||| ||||| || ||||||||||||||| ||||| ||||||||||| |
|
|
| T |
2208999 |
aaaatgccgaaattgttagatcggatgtcatgactgagattcgaatcccgatacctccactt--gtatgtgagtttataatgactttgtcatttcgtcta |
2208902 |
T |
 |
| Q |
649 |
tctac |
653 |
Q |
| |
|
||||| |
|
|
| T |
2208901 |
tctac |
2208897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 528 - 624
Target Start/End: Complemental strand, 11797522 - 11797428
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||| |||| ||||||||| || |||||||||||||||| ||| |||||||||| ||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
11797522 |
aagtcctaactcaactggcaaaa--tgtcgaaattgttaggccgaatgtcatgaccgggattcgaacattggtacctccacttatgtgtgtgagttt |
11797428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 548 - 640
Target Start/End: Original strand, 13116949 - 13117042
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttataatggctttgccat |
640 |
Q |
| |
|
||||||| |||||||||||||| ||| | ||||||| ||||||||| ||||||||||||| || ||||||||||||||| ||| ||||||||| |
|
|
| T |
13116949 |
aaaaatgtcgaaattgttaggctggacgtcatgaccaaggttcgaactccggtaccttcactttgtgtgtgtgagtttatgatgactttgccat |
13117042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 531 - 643
Target Start/End: Original strand, 27868285 - 27868397
Alignment:
| Q |
531 |
tcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcactta-tgtgtgtgagtttataat |
629 |
Q |
| |
|
|||||||||| ||| |||||| | ||||||||||||||||||| | | || ||||||||| |||| |||||| | ||||| ||||||||||||||| || |
|
|
| T |
27868285 |
tcctagctcaactgacaaaaa-taccgaaattgttaggccggacgtcttggccggggttcaaacctcggtacttccactttgtgtgtgtgagtttatgat |
27868383 |
T |
 |
| Q |
630 |
ggctttgccatttc |
643 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
27868384 |
ggctttgccatttc |
27868397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 600 - 652
Target Start/End: Complemental strand, 45191613 - 45191561
Alignment:
| Q |
600 |
taccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45191613 |
tacctccacttgtgtgtgtgagtttataatggctttgccatttcgtctatcta |
45191561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 552 - 654
Target Start/End: Original strand, 12502727 - 12502830
Alignment:
| Q |
552 |
atgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttataatggctttgccatttcgtctatc |
650 |
Q |
| |
|
|||| ||||||||||||||||| | ||||| ||||||||||| ||||||||| || || ||||||||||||||| |||||||| |||| || |||||| |
|
|
| T |
12502727 |
atgctgaaattgttaggccggacgtcatgattggggttcgaactccggtacctcaactttgtgtgtgtgagtttatgatggctttaccatctcctctatc |
12502826 |
T |
 |
| Q |
651 |
tacc |
654 |
Q |
| |
|
|||| |
|
|
| T |
12502827 |
tacc |
12502830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 577 - 652
Target Start/End: Complemental strand, 45566785 - 45566710
Alignment:
| Q |
577 |
catgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||| ||||||||| |||||| || || ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45566785 |
catgaccggagttcgaacctttgtacctccatttgtgtgtgtgagtttataatgactttgccatttcgtctatcta |
45566710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 587 - 653
Target Start/End: Original strand, 7182676 - 7182742
Alignment:
| Q |
587 |
gttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||| |||| ||||| |||||||||||| ||||||| |||||||| |||||||||||||||||| |
|
|
| T |
7182676 |
gttcgaatcccgatacctccacttatgtgtgggagtttacaatggcttagccatttcgtctatctac |
7182742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 531 - 640
Target Start/End: Complemental strand, 8793296 - 8793187
Alignment:
| Q |
531 |
tcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttataat |
629 |
Q |
| |
|
|||||||||| |||||||||| | | ||||||||| |||| | | |||||||||||||||||||||||||||| ||| || ||||||||||||||| || |
|
|
| T |
8793296 |
tcctagctcaactggcaaaaa-tatcaaaattgttaagccgtacgtcatgaccggggttcgaaccccggtacctccactttgtgtgtgtgagtttatgat |
8793198 |
T |
 |
| Q |
630 |
ggctttgccat |
640 |
Q |
| |
|
| |||| |||| |
|
|
| T |
8793197 |
gactttaccat |
8793187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 548 - 653
Target Start/End: Original strand, 16939466 - 16939574
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggta---ccttcacttatgtgtgtgagtttataatggctttgccatttcg |
644 |
Q |
| |
|
||||||||||||||||||||| | |||| |||| ||||||||||||||| ||||||||||||||||||||||||| ||| ||||| ||||||| |
|
|
| T |
16939466 |
aaaaatgccgaaattgttaggtcagatgttatgattggggttcgaaccccgacgacgccttcacttatgtgtgtgagtttatgatgcctttgtcatttcg |
16939565 |
T |
 |
| Q |
645 |
tctatctac |
653 |
Q |
| |
|
| ||||||| |
|
|
| T |
16939566 |
tttatctac |
16939574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 524 - 652
Target Start/End: Complemental strand, 22561294 - 22561159
Alignment:
| Q |
524 |
ccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaacc---------ccggtaccttcacttatgt |
614 |
Q |
| |
|
||||||||||||| | | ||||||||| | ||||||||||||||||||||||| ||| |||||||| |||| ||||||||| ||||| ||| |
|
|
| T |
22561294 |
ccagaagtcctagtttaactggcaaaata--ccgaaattgttaggccggatgccgtgatcggggttcaaaccgttcaaaccccggtacctccacttgtgt |
22561197 |
T |
 |
| Q |
615 |
gtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
22561196 |
gtgtgagtttataataactttgtcattttgtctatcta |
22561159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 550 - 652
Target Start/End: Original strand, 44041510 - 44041612
Alignment:
| Q |
550 |
aaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
||||||||||||| ||||| |||||| |||| |||| ||||||| || |||| | ||||||| | ||| |||||||||| |||||| |||||||||||| |
|
|
| T |
44041510 |
aaatgccgaaattattaggtcggatgttatgatcgggattcgaactccagtacatccacttatatatgtaagtttataatagctttgtcatttcgtctat |
44041609 |
T |
 |
| Q |
650 |
cta |
652 |
Q |
| |
|
||| |
|
|
| T |
44041610 |
cta |
44041612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 548 - 649
Target Start/End: Original strand, 8050505 - 8050606
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||| |||||||||||||||| ||| ||||||||||||| || ||||||||| |||||||| | |||||||||||| ||||| |||||| ||| |
|
|
| T |
8050505 |
aaaaatgtcgaaattgttaggccgaatgttatgaccggggttcaaattccggtacctctacttatgtatatgagtttataataactttgtcatttcatct |
8050604 |
T |
 |
| Q |
648 |
at |
649 |
Q |
| |
|
|| |
|
|
| T |
8050605 |
at |
8050606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 521 - 652
Target Start/End: Original strand, 30455202 - 30455317
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||| | |||||| |||||||||||||||||||||||||| ||| ||||| ||||| ||| ||||| |
|
|
| T |
30455202 |
tatccagaagtcctagctcaactg--ataaaatgtcgaaattgttaggccggatgccatgatcgg--------------tacctccacttgtgtatgtga |
30455285 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |
|
|
| T |
30455286 |
gtttataatgactttgccatttcgtctatcta |
30455317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 548 - 604
Target Start/End: Complemental strand, 17540181 - 17540125
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacct |
604 |
Q |
| |
|
||||||||||||||||||||||| || | |||||||||||||||||||||| ||||| |
|
|
| T |
17540181 |
aaaaatgccgaaattgttaggccagacgtcatgaccggggttcgaaccccgatacct |
17540125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 531 - 654
Target Start/End: Original strand, 43837095 - 43837216
Alignment:
| Q |
531 |
tcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttataat |
629 |
Q |
| |
|
|||||||||| |||||||||| || || ||||||||||||||||| |||||| ||||| || |||||||||| ||| |||||||||| ||||||| || |
|
|
| T |
43837095 |
tcctagctcaactggcaaaaa-tgtcggaattgttaggccggatgttatgacc-aggttc-aaacccggtacctccactttatgtgtgtaagtttatcat |
43837191 |
T |
 |
| Q |
630 |
ggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
| ||||||||| || |||||||||| |
|
|
| T |
43837192 |
gactttgccatctcttctatctacc |
43837216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 548 - 654
Target Start/End: Complemental strand, 8312633 - 8312526
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
||||||| |||||||||||||||| | | |||| || ||||||||||||||||||| ||| || |||| |||||||||| |||||||||||| || | |
|
|
| T |
8312633 |
aaaaatgtcgaaattgttaggccgaacgttatgatcgaggttcgaaccccggtacctccactttgtgtgagtgagtttatggtggctttgccatctcttt |
8312534 |
T |
 |
| Q |
647 |
tatctacc |
654 |
Q |
| |
|
|||||||| |
|
|
| T |
8312533 |
tatctacc |
8312526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 548 - 654
Target Start/End: Complemental strand, 13874244 - 13874137
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag-tttataatggctttgccatttcgtc |
646 |
Q |
| |
|
|||||||| |||||||||||| |||||| |||| ||| || ||||| ||||||||| || || | |||||||| ||||||||| |||| ||||||||| |
|
|
| T |
13874244 |
aaaaatgctgaaattgttaggtcggatgatatgatcggtgtgcgaactccggtacctccatttgtatgtgtgagttttataatgattttgtcatttcgtc |
13874145 |
T |
 |
| Q |
647 |
tatctacc |
654 |
Q |
| |
|
|||||||| |
|
|
| T |
13874144 |
tatctacc |
13874137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 611 - 654
Target Start/End: Complemental strand, 43907266 - 43907223
Alignment:
| Q |
611 |
atgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43907266 |
atgtgtgtgagtttataatggctttgtcatttcgtctatctacc |
43907223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 528 - 653
Target Start/End: Complemental strand, 4628088 - 4627963
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttat |
626 |
Q |
| |
|
||||||||||||| ||| |||||| ||| |||||||||||||| || | ||| | || |||| |||| ||||||||||||| |||||||||||| ||||| |
|
|
| T |
4628088 |
aagtcctagctcaactgacaaaaa-tgctgaaattgttaggccagacgtcataatcgaggtttgaactccggtaccttcactttatgtgtgtgaatttat |
4627990 |
T |
 |
| Q |
627 |
aatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||| |||| | ||| ||||||||| |
|
|
| T |
4627989 |
tatggttttgtcctttaatctatctac |
4627963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 549 - 654
Target Start/End: Complemental strand, 31278546 - 31278444
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||| ||||| |||||| ||||| |||||||| ||||||||||| | ||||| || || |||||| |||||||||||| ||||| |||||||||| |
|
|
| T |
31278546 |
aaaatgctgaaatagttaggttggatgtcatgaccgaggttcgaaccc-gatacctccattt--gtgtgtaagtttataatggttttgctatttcgtcta |
31278450 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
31278449 |
tctacc |
31278444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 549 - 627
Target Start/End: Original strand, 37771093 - 37771171
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttata |
627 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||| ||||||||||| ||||||||| || || ||| |||||||||||| |
|
|
| T |
37771093 |
aaaatgtcgaaattgttaggccggatatcatgatcggggttcgaattccggtacctccatttgtgtatgtgagtttata |
37771171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 557 - 654
Target Start/End: Complemental strand, 7599620 - 7599523
Alignment:
| Q |
557 |
gaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||| ||| |||| ||||| ||| ||| ||||| | || || ||||| ||| |||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
7599620 |
gaaattgttaagccagatgtcatgattgggattcaaaccctgatatctccacttgtgtctgtgagtttataatagctttgtcatttcgtctatctacc |
7599523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 612 - 653
Target Start/End: Complemental strand, 8291793 - 8291752
Alignment:
| Q |
612 |
tgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8291793 |
tgtgtgcgagtttataatggctttgccatttcgtctatctac |
8291752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 548 - 652
Target Start/End: Complemental strand, 11081066 - 11080961
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
||||||| ||||||| ||||||||| | ||||||||||||| ||||||| ||||| ||| |||||||| ||||| ||| |||| |||| ||| ||||| |
|
|
| T |
11081066 |
aaaaatgttgaaattgctaggccggacgttatgaccggggttcaaaccccgatacctccactttatgtgtatgagtatatgatggttttgtcatctcgtc |
11080967 |
T |
 |
| Q |
647 |
tatcta |
652 |
Q |
| |
|
|||||| |
|
|
| T |
11080966 |
tatcta |
11080961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 548 - 650
Target Start/End: Original strand, 22332180 - 22332284
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg--agtttataatggctttgccatttcgt |
645 |
Q |
| |
|
||||||| ||||||||||||||| |||| |||| ||| ||||||| | ||||||| |||||||||||||| |||||| |||| |||| |||||||| |
|
|
| T |
22332180 |
aaaaatgtcgaaattgttaggccagatgttatgatcggagttcgaatcatggtacctccacttatgtgtgtgtaagtttacaatgactttatcatttcgt |
22332279 |
T |
 |
| Q |
646 |
ctatc |
650 |
Q |
| |
|
||||| |
|
|
| T |
22332280 |
ctatc |
22332284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 526 - 596
Target Start/End: Complemental strand, 5055912 - 5055845
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
596 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||| | ||||||| |||||||||||| |
|
|
| T |
5055912 |
agaagtcctagctcagctggcaaa---tgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
5055845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 548 - 652
Target Start/End: Complemental strand, 43841883 - 43841780
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||| ||||||||||||| ||||| | ||||| ||| || |||||||| ||||||||||| ||| ||||| |||||||| |||| ||||| |||| |
|
|
| T |
43841883 |
aaaaatgtcgaaattgttaggtcggatactatgactggg-ttagaaccccgataccttcacttgtgtctgtgaatttataattactttatcatttggtct |
43841785 |
T |
 |
| Q |
648 |
atcta |
652 |
Q |
| |
|
||||| |
|
|
| T |
43841784 |
atcta |
43841780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 598 - 653
Target Start/End: Original strand, 23913681 - 23913736
Alignment:
| Q |
598 |
ggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||| ||||| |||||||||| |
|
|
| T |
23913681 |
ggtacctccacttatgtgtgtgagtttataataactttgtcattttgtctatctac |
23913736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 558 - 652
Target Start/End: Original strand, 35068907 - 35069002
Alignment:
| Q |
558 |
aaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcactta-tgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||| | ||||| || |||||||| || ||||| ||||| ||||||||||||||| | ||||||||||| ||||||||||| |
|
|
| T |
35068907 |
aaattgttaggccggacgtcatgatcgaggttcgaattccaatacctccactttgtgtgtgtgagtttatgacggctttgccatctcgtctatcta |
35069002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 577 - 654
Target Start/End: Original strand, 27227135 - 27227213
Alignment:
| Q |
577 |
catgaccggggttcgaaccccggtaccttcactt-atgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||| ||||||||||||||| ||| || ||||| |||||| |||||||| ||| ||||||||| ||||||||||||| |
|
|
| T |
27227135 |
catgatcggggttcgaacccctgtaactccactttatgtgtatgagtttaggatgactttgccatctcgtctatctacc |
27227213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 620 - 654
Target Start/End: Complemental strand, 27235004 - 27234970
Alignment:
| Q |
620 |
agtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
27235004 |
agtttataatggctttgccatttcgtctatctacc |
27234970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 528 - 653
Target Start/End: Complemental strand, 33132859 - 33132736
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttata |
627 |
Q |
| |
|
|||||||| |||| ||||||||| || | ||||||||||| ||||| |||||| || ||||||||| | ||||| ||||| | |||||||||||||| |
|
|
| T |
33132859 |
aagtcctaactcaactggcaaaatat--caaaattgttaggtcggataccatgatcgaagttcgaacctcaatacctccacttttatgtgtgagtttata |
33132762 |
T |
 |
| Q |
628 |
atggctttgccatttcgtctatctac |
653 |
Q |
| |
|
| | |||| ||||||| |||||||| |
|
|
| T |
33132761 |
acgactttatcatttcgcctatctac |
33132736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 526 - 618
Target Start/End: Complemental strand, 3840487 - 3840398
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgt |
618 |
Q |
| |
|
||||||||||||||| ||||||||| || |||||||||||||| ||||| ||||| |||||||||| | |||||||| | ||| ||||||| |
|
|
| T |
3840487 |
agaagtcctagctcaactggcaaaa--tgtcgaaattgttaggctggatgtcatga-tggggttcgaatctcggtacctcctcttgtgtgtgt |
3840398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 620 - 653
Target Start/End: Original strand, 18216566 - 18216599
Alignment:
| Q |
620 |
agtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
18216566 |
agtttataatggctttgccatttcgtctatctac |
18216599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 612 - 653
Target Start/End: Original strand, 19051014 - 19051055
Alignment:
| Q |
612 |
tgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
19051014 |
tgtgtgtgagtttatgatggctttgccatctcgtctatctac |
19051055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 612 - 653
Target Start/End: Complemental strand, 42695714 - 42695673
Alignment:
| Q |
612 |
tgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
42695714 |
tgtgtgtgaatttataatggcttttccatttcgtctatctac |
42695673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 12176520 - 12176624
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcactt-atgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
|||||| |||||||| ||| |||| | ||||| ||||||| || |||||||||| ||||| |||||||||| |||| ||||||||||||| || ||| |
|
|
| T |
12176520 |
aaaatgtcgaaattgatagatcggacgtcatgattggggttcaaatcccggtacctccactttatgtgtgtgaaattatgatggctttgccatctcatct |
12176619 |
T |
 |
| Q |
648 |
atcta |
652 |
Q |
| |
|
||||| |
|
|
| T |
12176620 |
atcta |
12176624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 600 - 652
Target Start/End: Original strand, 16261166 - 16261218
Alignment:
| Q |
600 |
taccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||| |||||| |||||||| |
|
|
| T |
16261166 |
tacctccacttatgtgtgtgagtttataatagctttatcatttcatctatcta |
16261218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 526 - 596
Target Start/End: Original strand, 32007078 - 32007145
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
596 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| |||||||| | ||||||| |||||||||||| |
|
|
| T |
32007078 |
agaagtcctagctcaactggcaaa---tgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
32007145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 526 - 596
Target Start/End: Original strand, 41808206 - 41808273
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
596 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| |||||||| | ||||||| |||||||||||| |
|
|
| T |
41808206 |
agaagtcctagctcaactggcaaa---tgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
41808273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 549 - 596
Target Start/End: Original strand, 25376215 - 25376262
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
596 |
Q |
| |
|
||||| ||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
25376215 |
aaaataccgaaattgttagaccggatttcatgaccggggttcgaaccc |
25376262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 523 - 652
Target Start/End: Original strand, 28381225 - 28381350
Alignment:
| Q |
523 |
tccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagt |
622 |
Q |
| |
|
|||| ||||||||||||| ||||| ||| || ||||||||||||| |||| | | ||| |||||| |||||||| |||| ||||||| |||| ||| |
|
|
| T |
28381225 |
tccataagtcctagctcaactggctaaa--tgtcgaaattgttaggacggacgtcttgattggggtttgaaccccgacacctccacttatatgtg--agt |
28381320 |
T |
 |
| Q |
623 |
ttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||| |||| |||| ||||||||| |
|
|
| T |
28381321 |
ttataatggttttgttattttgtctatcta |
28381350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 528 - 642
Target Start/End: Original strand, 32947624 - 32947738
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcactt-atgtgtgtgagtttat |
626 |
Q |
| |
|
||||||||||||| ||| |||||| || |||||||||||||| | | | ||||||| |||||||||||| | || ||||| |||||||||||||||| |
|
|
| T |
32947624 |
aagtcctagctcaactgacaaaaa-tgttaaaattgttaggccgaacgtcttgaccggagttcgaaccccgacatctccactttatgtgtgtgagtttat |
32947722 |
T |
 |
| Q |
627 |
aatggctttgccattt |
642 |
Q |
| |
|
|||| |||| ||||| |
|
|
| T |
32947723 |
gatggttttgtcattt |
32947738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 548 - 650
Target Start/End: Complemental strand, 37315159 - 37315056
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
|||||||||||||||||||||| ||| | ||||| | | ||||||||| ||| |||| ||| || ||||||||||||| | || ||||| ||| ||||| |
|
|
| T |
37315159 |
aaaaatgccgaaattgttaggctggacgtcatgatccgagttcgaacctcggaacctccactttgtgtgtgtgagtttgtgttgactttgtcatctcgtc |
37315060 |
T |
 |
| Q |
647 |
tatc |
650 |
Q |
| |
|
|||| |
|
|
| T |
37315059 |
tatc |
37315056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 548 - 603
Target Start/End: Original strand, 52427232 - 52427287
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacc |
603 |
Q |
| |
|
|||||| || ||||||||||||| ||||| |||| |||||||| |||||||||||| |
|
|
| T |
52427232 |
aaaaataccaaaattgttaggccagatgctatgatcggggttcaaaccccggtacc |
52427287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 549 - 626
Target Start/End: Original strand, 2735815 - 2735892
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttat |
626 |
Q |
| |
|
||||||| |||||||||| | ||| | |||||||| |||||||||||| |||| ||||| ||||||||||||||| |
|
|
| T |
2735815 |
aaaatgcagaaattgttaagtaggacgtcatgaccgttgttcgaaccccgacacctccacttgtgtgtgtgagtttat |
2735892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 615 - 652
Target Start/End: Original strand, 12663677 - 12663714
Alignment:
| Q |
615 |
gtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
12663677 |
gtgtgagtttataatgactttgtcatttcgtctatcta |
12663714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 549 - 626
Target Start/End: Original strand, 28565145 - 28565222
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttat |
626 |
Q |
| |
|
|||||| || ||||||||| | | ||||||||||| | ||| |||||||| ||||| |||||||||||||| ||||| |
|
|
| T |
28565145 |
aaaatgtcgtaattgttagactgaatgccatgaccagagtttgaaccccgatacctctacttatgtgtgtgactttat |
28565222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 616 - 649
Target Start/End: Complemental strand, 39787663 - 39787630
Alignment:
| Q |
616 |
tgtgagtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
39787663 |
tgtgagtttataatgactttgccatttcgtctat |
39787630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0287 (Bit Score: 112; Significance: 4e-56; HSPs: 1)
Name: scaffold0287
Description:
Target: scaffold0287; HSP #1
Raw Score: 112; E-Value: 4e-56
Query Start/End: Original strand, 516 - 654
Target Start/End: Complemental strand, 1193 - 1057
Alignment:
| Q |
516 |
tatagtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtg |
615 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |||| |
|
|
| T |
1193 |
tatagtatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccctggtacctccacttgtgtg |
1096 |
T |
 |
| Q |
616 |
tgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1095 |
tgtgagtttataatggctttgccatttcgtctatctacc |
1057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0402 (Bit Score: 111; Significance: 1e-55; HSPs: 1)
Name: scaffold0402
Description:
Target: scaffold0402; HSP #1
Raw Score: 111; E-Value: 1e-55
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 1371 - 1240
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
1371 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
1274 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
1273 |
gtttataatggctttgccatttcgtctatctacc |
1240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 111; Significance: 1e-55; HSPs: 101)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 111; E-Value: 1e-55
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 8448272 - 8448141
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
8448272 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
8448175 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8448174 |
gtttataatggctttgccatttcgtctatctacc |
8448141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 111; E-Value: 1e-55
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 8457076 - 8456945
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
8457076 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
8456979 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8456978 |
gtttataatggctttgccatttcgtctatctacc |
8456945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 107; E-Value: 3e-53
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 16496783 - 16496650
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
16496783 |
tatccagaagtcctagctcaactggcaaaaa-tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcctccacttatgtgtgtga |
16496685 |
T |
 |
| Q |
621 |
g-tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||| |
|
|
| T |
16496684 |
gttttataatggctttgccatttcgtctatctacc |
16496650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 103; E-Value: 8e-51
Query Start/End: Original strand, 525 - 654
Target Start/End: Complemental strand, 18861893 - 18861766
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| ||||||||||||| |
|
|
| T |
18861893 |
cagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
18861796 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
18861795 |
ataatggctttgccatttcgtctatctacc |
18861766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 101; E-Value: 1e-49
Query Start/End: Original strand, 522 - 653
Target Start/End: Complemental strand, 8329687 - 8329558
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| ||||||||||||| ||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
8329687 |
atccaaaagtcctagctcaactggcaata--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
8329590 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
8329589 |
tttataatggctttgccatttcgtctatctac |
8329558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 101; E-Value: 1e-49
Query Start/End: Original strand, 521 - 652
Target Start/End: Original strand, 8939624 - 8939753
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||| |||||| |||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
8939624 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
8939721 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
8939722 |
gtttataatggctttgccatttcgtctatcta |
8939753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 101; E-Value: 1e-49
Query Start/End: Original strand, 521 - 652
Target Start/End: Complemental strand, 31205313 - 31205184
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |||||| ||||| ||||||||| |
|
|
| T |
31205313 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgatcggggttcgaaccccagtacctccacttgtgtgtgtga |
31205216 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
31205215 |
gtttataatggctttgccatttcgtctatcta |
31205184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 98; E-Value: 8e-48
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 10330802 - 10330934
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||| ||||||||||||| |||||||||| |||| ||||||||||||| |||||||||||||||| |||||||||||||||| ||||| ||||||||| |
|
|
| T |
10330802 |
tatccacaagtcctagctcaactggcaaaaa-tgccaaaattgttaggccagatgccatgaccggggatcgaaccccggtacctccacttgtgtgtgtga |
10330900 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
10330901 |
gtttataatggctttgccatttcgtctatctacc |
10330934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 97; E-Value: 3e-47
Query Start/End: Original strand, 520 - 654
Target Start/End: Original strand, 735442 - 735572
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |||||||| |
|
|
| T |
735442 |
gtatccagaagttctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccact--tgtgtgtg |
735537 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
735538 |
agtttataatggctttgccatttcgtctatctacc |
735572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 4480472 - 4480603
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||||||||| |||| ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
4480472 |
tatccagaagtcctaactcaactggcaaaa--tgccgaaattgttaggccggatgccatgattggggttcgaaccccgttacctccacttgtgtgtgtga |
4480569 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
4480570 |
gtttataatggctttgccatttcgtctatctacc |
4480603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 525 - 654
Target Start/End: Complemental strand, 12795145 - 12795018
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| || | |||| ||||||||||||||||||||||| ||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
12795145 |
cagaagtcctagctcaactagtaaaa--tgccgaaattgttaggccggatgtcatgaccggggttcgaaccgcggtacctccacttatgtgtgtgagttt |
12795048 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12795047 |
ataatggctttgccatttcgtctatctacc |
12795018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 525 - 653
Target Start/End: Original strand, 1241597 - 1241723
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| ||||| ||||| ||||||||||||| |
|
|
| T |
1241597 |
cagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgaccggggttcgaaccccgctacctccacttgtgtgtgtgagttt |
1241694 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||||||||| ||||||||||| |
|
|
| T |
1241695 |
ataatggctttgccattccgtctatctac |
1241723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 31444420 - 31444291
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| | |||||||| |||||||||||||||||||| ||||||||| ||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
31444420 |
atccagaagtcctagctcaaccggcaaaaa-tgccgaaattgttaggccgggtgccatgactggggttcgaaccccggtacctccacttatg--tgtgag |
31444324 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
31444323 |
tttataatggctttgccatttcgtctatctacc |
31444291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 93; E-Value: 8e-45
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 2314728 - 2314596
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcact--tatgtgtgtg |
619 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| | |||||||| |
|
|
| T |
2314728 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgtg |
2314631 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2314630 |
agtttataatgactttgccatttcgtctatctacc |
2314596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 93; E-Value: 8e-45
Query Start/End: Original strand, 549 - 653
Target Start/End: Original strand, 2959017 - 2959121
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2959017 |
aaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtcta |
2959116 |
T |
 |
| Q |
649 |
tctac |
653 |
Q |
| |
|
||||| |
|
|
| T |
2959117 |
tctac |
2959121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 93; E-Value: 8e-45
Query Start/End: Original strand, 522 - 653
Target Start/End: Original strand, 4083586 - 4083715
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||| ||||||||||||||||||||||||| ||||||||| ||||| |||| ||||| |
|
|
| T |
4083586 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggtcggatgccatgaccggggttcgaacaccggtacctccacttgtgtgcgtgag |
4083683 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |
|
|
| T |
4083684 |
tttataatggctttgccattttgtctatctac |
4083715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 91; E-Value: 1e-43
Query Start/End: Original strand, 525 - 654
Target Start/End: Complemental strand, 32107961 - 32107834
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||||||| ||||| ||||| |||||||||||||||||||| | ||||| ||||||||||||| |
|
|
| T |
32107961 |
cagaagtcctagctcaactggcaaaa--tgccgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacttccacttgtgtgtgtgagttt |
32107864 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32107863 |
ataatggctttgccatttcgtctatctacc |
32107834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 5603576 - 5603446
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
|||||||||| |||||||| |||| ||||||||||||||| ||||||||||||||||||||||||||||||||| | ||||| ||||| |||||||||| |
|
|
| T |
5603576 |
atccagaagttctagctcaactgg--aaaaatgccgaaattattaggccggatgccatgaccggggttcgaaccctgatacctccacttgtgtgtgtgag |
5603479 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
5603478 |
tttataatgactttgccatttcgtctatctacc |
5603446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 10181044 - 10181174
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||| |||||| | ||| |||||||||||||| ||||||| ||||| |||||||||| |
|
|
| T |
10181044 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggtcggatgtcgtgatcggggttcgaaccctggtacctccacttgtgtgtgtgag |
10181141 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
10181142 |
tttataatggctttgccatttcgtctatctacc |
10181174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 521 - 652
Target Start/End: Complemental strand, 17534653 - 17534523
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| ||| ||||| ||||||||| |
|
|
| T |
17534653 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtgcctccacttgtgtgtgtga |
17534556 |
T |
 |
| Q |
621 |
g-tttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
| ||||||||||||||| ||||||||||||||| |
|
|
| T |
17534555 |
gttttataatggctttgtcatttcgtctatcta |
17534523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 526 - 654
Target Start/End: Original strand, 1855008 - 1855135
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||||| | | |||||||||| || ||| |||||||||||||||||||||| |||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
1855008 |
agaagtcctagtttaactggcaaaaa-tgtcgatattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttta |
1855106 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1855107 |
taatggctttgccatttcgtctatctacc |
1855135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 521 - 652
Target Start/End: Complemental strand, 13507440 - 13507311
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| |||| |||| ||||||||||||||||| ||||||||||||||| |||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
13507440 |
tatccagaagtcctagctcaactgggaaaa--tgccgaaattgttaggctggatgccatgaccggtgttcgaaccccgatacctccacttgtgtgtgtga |
13507343 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |
|
|
| T |
13507342 |
gtttataatggctttgccatttcgtccatcta |
13507311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 88; E-Value: 7e-42
Query Start/End: Original strand, 553 - 652
Target Start/End: Original strand, 5660427 - 5660526
Alignment:
| Q |
553 |
tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5660427 |
tgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtctatcta |
5660526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 549 - 654
Target Start/End: Complemental strand, 1686338 - 1686232
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag-tttataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1686338 |
aaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttttataatggctttgccatttcgtct |
1686239 |
T |
 |
| Q |
648 |
atctacc |
654 |
Q |
| |
|
||||||| |
|
|
| T |
1686238 |
atctacc |
1686232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 7098805 - 7098935
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| |||| |||| || ||||||||||||||||||||||||||| ||||||||||| ||||||| ||||| |||||||||| |
|
|
| T |
7098805 |
atccagaagtcctagctcaactggtaaaa--tgtcgaaattgttaggccggatgccatgactagggttcgaaccttggtacctccacttgtgtgtgtgag |
7098902 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
7098903 |
tttataatggctttgccatttcgtctatctacc |
7098935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 85; E-Value: 5e-40
Query Start/End: Original strand, 522 - 653
Target Start/End: Original strand, 4996871 - 4997000
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||| ||||| ||| ||||||||||||||||||||||||| ||||||||||| ||| |||||| ||||| |||||||||| |
|
|
| T |
4996871 |
atccagaagtcctagctcaactgacaaaa--tgctgaaattgttaggccggatgccatgatcggggttcgaatcccagtacctccacttgtgtgtgtgag |
4996968 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |
|
|
| T |
4996969 |
tttataatagctttgccatttcgtctatctac |
4997000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 522 - 652
Target Start/End: Original strand, 8977153 - 8977282
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| ||||| ||||||| |||||||||| |||| |||||||||||||||||| ||||| |||||||||||||||||||||| || || |||||||||| |
|
|
| T |
8977153 |
atccacaagtcttagctcaactggcaaaaa-tgcccaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccatttgtgtgtgtgag |
8977251 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |
|
|
| T |
8977252 |
tttataatggttttgccatttcgtctatcta |
8977282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 520 - 652
Target Start/End: Original strand, 6266629 - 6266759
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
|||||| |||||| ||||||| ||||||||| || |||||||||||| ||||||| ||||||||| |||||||||||||||||| ||||| |||||||| |
|
|
| T |
6266629 |
gtatccggaagtcttagctcaactggcaaaa--tgtcgaaattgttagaccggatgtcatgaccggagttcgaaccccggtacctccacttgtgtgtgtg |
6266726 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
6266727 |
agtttataatggctttgccatttcatctatcta |
6266759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 32643858 - 32643723
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtg--- |
617 |
Q |
| |
|
||||||||||||||| |||| |||| |||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |||||| |
|
|
| T |
32643858 |
tatccagaagtcctaactcaactggtaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaatcccggtacctccacttgtgtgtgtgt |
32643761 |
T |
 |
| Q |
618 |
-tgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32643760 |
ctgagtttataatggctttaccatttcgtctatctacc |
32643723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 34287300 - 34287170
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||| ||| ||| ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |||| |
|
|
| T |
34287300 |
atccagaagtcatagttcaactggcaaaa--tgccgacattgttaggccggatgccatgaccggggttcgaaccccggtactttcacttgtgtgtatgag |
34287203 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||| |||| |||||||||||||||||| ||||| |
|
|
| T |
34287202 |
tttctaatagctttgccatttcgtctaactacc |
34287170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 549 - 652
Target Start/End: Complemental strand, 31747090 - 31746986
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga-gtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| ||| |
|
|
| T |
31747090 |
aaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtaccttcacttatgtgtgtgaggtttataatggctttgtcattttatct |
31746991 |
T |
 |
| Q |
648 |
atcta |
652 |
Q |
| |
|
||||| |
|
|
| T |
31746990 |
atcta |
31746986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 520 - 653
Target Start/End: Complemental strand, 5626191 - 5626060
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
||||| |||| |||||||||| |||| ||||||||||||||||||||| | ||| |||||| ||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
5626191 |
gtatctagaaatcctagctcaactgg--aaaaatgccgaaattgttaggtagtatgtcatgactggggttcgaaccccggtacctccacttgtgtgtgtg |
5626094 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
5626093 |
agtttataatggctttaccatttcgtctatctac |
5626060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 78; E-Value: 7e-36
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 4891007 - 4891137
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||| ||||||| |||| ||||||||||||||||||||||| |||| ||||||||||||| ||| | || ||||| |||||||||||||||| |
|
|
| T |
4891007 |
atccagaagtcttagctcaactgg--aaaaatgccgaaattgttaggccagatgtcatgaccggggtttgaatctcgatacctccacttatgtgtgtgag |
4891104 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |
|
|
| T |
4891105 |
tttataatggctttgccattttatctatctacc |
4891137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 78; E-Value: 7e-36
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 10531385 - 10531515
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
|||||||||| |||||||| ||| ||||| || ||||||||||||||||||||| |||| |||||||||||||||||||||| ||||| | |||||||| |
|
|
| T |
10531385 |
atccagaagttctagctcaactgacaaaatat--cgaaattgttaggccggatgctatgatcggggttcgaaccccggtacctccacttttatgtgtgag |
10531482 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||| |
|
|
| T |
10531483 |
tttataatggctttgccacttcgtctatttacc |
10531515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 78; E-Value: 7e-36
Query Start/End: Original strand, 521 - 653
Target Start/End: Complemental strand, 13540291 - 13540161
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||||||||||||||||||| ||||||||| || ||| |||||||| | ||||| ||||||||| |
|
|
| T |
13540291 |
tatccagaagtcctagctcaaatggcaaaa--tgccgaaattgttaggccggatgcaatgaccgggatttgaatcccggtacgtccacttgtgtgtgtga |
13540194 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||| |
|
|
| T |
13540193 |
gtttataatggttttgccatttcgtctttctac |
13540161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 78; E-Value: 7e-36
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 29183657 - 29183787
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||| |||| | |||| ||||||||||||||||||||||||||||||||||||||| || || ||||| |||||||||| |
|
|
| T |
29183657 |
atccagaagtcctagctcaattggtaaaata--ccgacattgttaggccggatgccatgaccggggttcgaaccccgatatctccacttgtgtgtgtgag |
29183754 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||| |||| |||||||||||||||||||||| |
|
|
| T |
29183755 |
tttattatggttttgccatttcgtctatctacc |
29183787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 526 - 652
Target Start/End: Complemental strand, 2301504 - 2301379
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag-ttt |
624 |
Q |
| |
|
|||| |||||||||| ||||||||| |||| ||||||||||| |||||| ||| |||||||||||||||||||||||| ||||| |||||||||| ||| |
|
|
| T |
2301504 |
agaaatcctagctcaactggcaaaa--tgccaaaattgttaggtcggatgtcataaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttt |
2301407 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
2301406 |
ataatggctttgccatttcgtctatcta |
2301379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 521 - 652
Target Start/End: Original strand, 31057830 - 31057959
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||| ||||||| ||||| ||| ||| || ||||||| |||||||| |||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
31057830 |
tatccagaagtcatagctcaactggcgaaa--tgctgacattgttaagccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
31057927 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| |
|
|
| T |
31057928 |
gtttataatggttttgtcatttcgtctatcta |
31057959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 525 - 654
Target Start/End: Original strand, 21513074 - 21513203
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcact--tatgtgtgtgagt |
622 |
Q |
| |
|
|||||||||||||||| ||||||||| || |||||||||||||||||||| ||||| |||||||||||||| |||||| |||| | ||||||||| | |
|
|
| T |
21513074 |
cagaagtcctagctcaactggcaaaa--tgtcgaaattgttaggccggatgtcatgattggggttcgaaccccagtacctccacttgtgtgtgtgtgaat |
21513171 |
T |
 |
| Q |
623 |
ttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
21513172 |
ttataatggctttgccatttcgtctatctacc |
21513203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 73; E-Value: 7e-33
Query Start/End: Original strand, 548 - 652
Target Start/End: Original strand, 9727518 - 9727622
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||| ||||||||||||||| |||||| ||||| ||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
9727518 |
aaaaatgtcgaaattgttaggccggataccatgatcggggttcgaacccctgtacctccacttgtgtgtgtgagtttataatgactttgtcatttcgtct |
9727617 |
T |
 |
| Q |
648 |
atcta |
652 |
Q |
| |
|
||||| |
|
|
| T |
9727618 |
atcta |
9727622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 8374166 - 8374269
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||||| | ||||| ||||||| ||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
8374166 |
aaaatgccgaaattgttaggcgggatgccatgatcggggttcgaaccctgatacctccacttatatgtgtgagtttataatggctttgtcattttgtcta |
8374265 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
8374266 |
tcta |
8374269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 522 - 628
Target Start/End: Complemental strand, 10263200 - 10263096
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |||||||||| |
|
|
| T |
10263200 |
atccagaagtcctagctcaactggcaaag--tgccgaaattgttaggccggatgccatgaccggggttcgaaccctagtacctccacttgtgtgtgtgag |
10263103 |
T |
 |
| Q |
622 |
tttataa |
628 |
Q |
| |
|
||||||| |
|
|
| T |
10263102 |
tttataa |
10263096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 525 - 654
Target Start/End: Complemental strand, 8487679 - 8487552
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||| ||||||| |||| |||| ||||||||||||||||||| |||| || | || | ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8487679 |
cagaagtcttagctcaactggtaaaa--tgccgaaattgttaggccgaatgctattatcgagattcgaaccccggtacctccacttatgtgtgtgagttt |
8487582 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||| |||||| |||||||||||||||| |
|
|
| T |
8487581 |
ataatgactttgctatttcgtctatctacc |
8487552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 15953232 - 15953363
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| |||| |||| ||||||||||||||| ||| ||| ||||||||||||||||||||||||||| ||||| | ||||||| |
|
|
| T |
15953232 |
tatccagaagtcctagctcaactggtaaaa--tgccgaaattgttagaccgaatgtaatgaccggggttcgaaccccggtacctccacttgtatgtgtga |
15953329 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||| |||| | ||||||||| |
|
|
| T |
15953330 |
gtttataatggctttgtcattctgcctatctacc |
15953363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 526 - 654
Target Start/End: Complemental strand, 24571742 - 24571616
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||||||||| ||| |||||||| ||||||||||||||| |||| ||||||| |||||||||||||| | ||| ||||| ||||||| |||||| |
|
|
| T |
24571742 |
agaagtcctagctcaactg--aaaaaatgtcgaaattgttaggccagatgtcatgaccagggttcgaaccccgttccctccacttgtgtgtgtaagttta |
24571645 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||| ||||| ||||||||||||||||| |
|
|
| T |
24571644 |
taatgactttgtcatttcgtctatctacc |
24571616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 548 - 654
Target Start/End: Complemental strand, 35164712 - 35164604
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcact--tatgtgtgtgagtttataatggctttgccatttcgt |
645 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| ||||| ||| |||| | ||||||||||||||||||||||||| |||||||| |
|
|
| T |
35164712 |
aaaaatgttgaaattgttaggccggatgccatgaccggggttcgaacaccggttcctccacttgtgtgtgtgtgagtttataatggctttgtcatttcgt |
35164613 |
T |
 |
| Q |
646 |
ctatctacc |
654 |
Q |
| |
|
||||||||| |
|
|
| T |
35164612 |
ctatctacc |
35164604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 549 - 649
Target Start/End: Complemental strand, 6556587 - 6556487
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||||||||||||| | |||| |||||||||||||||||||||| || || |||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
6556587 |
aaaatgccgaaattgttaggccggattctatgatcggggttcgaaccccggtacctccaattgtgtgtgtgagtttacaatgactttgccatttcgtcta |
6556488 |
T |
 |
| Q |
649 |
t |
649 |
Q |
| |
|
| |
|
|
| T |
6556487 |
t |
6556487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 521 - 652
Target Start/End: Complemental strand, 8116876 - 8116747
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||| ||||||||||| | ||||||||| || |||||||||||||||||||||| ||| ||| |||||||||||| ||| | |||| ||||||||| |
|
|
| T |
8116876 |
tatccacaagtcctagcttaactggcaaaatat--cgaaattgttaggccggatgccgtgatcggagttcgaaccccgatacttctacttgtgtgtgtga |
8116779 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |
|
|
| T |
8116778 |
gtttataatagctttgccatttcgtctatcta |
8116747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 11242727 - 11242598
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| || | |||||||||||||||||||| ||||||||||||| |||||||||||||| || ||| |||| ||||||||| |
|
|
| T |
11242727 |
tatccagaagtcctagctcaacta--ataaaatgccgaaattgttaggacggatgccatgactggggttcgaacccctgttcctccact--tgtgtgtga |
11242632 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||| || |||| ||||||||||||||||| |
|
|
| T |
11242631 |
gtttataacggatttgtcatttcgtctatctacc |
11242598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 565 - 652
Target Start/End: Original strand, 34539332 - 34539419
Alignment:
| Q |
565 |
taggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| |||||| |||||| |||||||| |
|
|
| T |
34539332 |
taggccggatgccatgaccggggttcgaaacccggtacctccacttatgtgtgtgagtttataatagctttgtcatttcatctatcta |
34539419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 34762692 - 34762795
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||| |||||||| |||||||||| ||||||| |||||||||||||||||| ||||||||| |||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
34762692 |
aaaatcccgaaattattaggccggacgccatgatcggggttcgaaccccggtgccttcacttgcgtgtgtgagtttttaatggcttcgccatttcgtcta |
34762791 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
34762792 |
tcta |
34762795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 520 - 652
Target Start/End: Complemental strand, 2395688 - 2395558
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
|||| |||||||||||| ||| || |||||| | ||||||||||||| |||||||||||||||||||||||| || | || ||||| |||||| |||| |
|
|
| T |
2395688 |
gtattcagaagtcctaggtcaactagcaaaataa--cgaaattgttaggtcggatgccatgaccggggttcgaatcctgatatcttcatttatgtatgtg |
2395591 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
2395590 |
agtttataatggctttgtcatttcgtctatcta |
2395558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 549 - 654
Target Start/End: Complemental strand, 10318991 - 10318886
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||| ||| ||||||||||||| |||||||||||||||| |||||||| ||||| ||||||||||| |
|
|
| T |
10318991 |
aaaatgtcgaaattgttaggttggatgccatgaccggagtttaaaccccggtacctccacttatgtgtgtgagattataatgactttgtcatttcgtcta |
10318892 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
10318891 |
tctacc |
10318886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 525 - 652
Target Start/End: Original strand, 2236236 - 2236361
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
||||| |||||||||| ||| ||||| |||||||||| |||||||||||| ||| || ||||||||||| ||||| ||| ||||| ||||||||||||| |
|
|
| T |
2236236 |
cagaattcctagctcaactgacaaaa--tgccgaaattattaggccggatgtcataactggggttcgaactccggttcctccacttgtgtgtgtgagttt |
2236333 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||| |||||||||||||||||||| |
|
|
| T |
2236334 |
ataatgattttgccatttcgtctatcta |
2236361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 523 - 654
Target Start/End: Original strand, 4128945 - 4129074
Alignment:
| Q |
523 |
tccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagt |
622 |
Q |
| |
|
|||||||||||||||||| |||| |||| | ||||||||||||||||||| ||| |||| |||||||||| ||| | ||| ||||| | | ||||||| |
|
|
| T |
4128945 |
tccagaagtcctagctcaactggtaaaata--ccgaaattgttaggccggacgccttgacgggggttcgaatccccgcccctccacttgtttatgtgagt |
4129042 |
T |
 |
| Q |
623 |
ttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4129043 |
ttataatggctttgccatttcgtctatctacc |
4129074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 522 - 652
Target Start/End: Original strand, 27866587 - 27866716
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
|||||||||||| |||||| |||||||| |||| |||||||||||||||||||||||| ||||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
27866587 |
atccagaagtcccagctcaattggcaaaa--tgccaaaattgttaggccggatgccatgatcggggttcgaaccccaatacctctacttgtgtgtgtgag |
27866684 |
T |
 |
| Q |
622 |
-tttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||| ||||| ||||||||||||||| |
|
|
| T |
27866685 |
ttttataatgtctttgtcatttcgtctatcta |
27866716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 550 - 649
Target Start/End: Original strand, 11152542 - 11152641
Alignment:
| Q |
550 |
aaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||||| |||||||| | ||||| |||||||||||||| ||| |||||||| |||||||||| |
|
|
| T |
11152542 |
aaatgccaaaattgttaagccggatgccatgaccggggttcgaatcccggtacatccacttgtgtgtgtgagtttacaatagctttgccttttcgtctat |
11152641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 548 - 626
Target Start/End: Complemental strand, 9949256 - 9949178
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttat |
626 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
9949256 |
aaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgaatttat |
9949178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 525 - 653
Target Start/End: Complemental strand, 23383182 - 23383056
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||| ||| || |||||| ||| |||||||||||| | |||| ||| | |||||||||||||||||||||| ||||| | | | ||||||| |
|
|
| T |
23383182 |
cagaagtcctagttcaactagcaaaa--tgctgaaattgttaggtcagatgtcataatcggggttcgaaccccggtacctccacttgtatatatgagttt |
23383085 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23383084 |
ataatggctttgccatttcgtctatctac |
23383056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 61; E-Value: 1e-25
Query Start/End: Original strand, 561 - 653
Target Start/End: Original strand, 659190 - 659282
Alignment:
| Q |
561 |
ttgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||| |||||| |||||||||||||| ||||||||||||| |||| ||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
659190 |
ttgttagatcggatgtcatgaccggggttcaaaccccggtacctctacttgtgtgtgtgaatttataatggctttgccatttcgtctatctac |
659282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 515 - 654
Target Start/End: Complemental strand, 2018899 - 2018761
Alignment:
| Q |
515 |
ttatagtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgt |
614 |
Q |
| |
|
||||| |||||||||||||||||||| |||| ||||| || ||||||||||||| | ||| |||||||| ||||||||| | | ||||| ||||| ||| |
|
|
| T |
2018899 |
ttataatatccagaagtcctagctcaactggtaaaaa-tgtcgaaattgttaggtcaaatgtcatgaccgtggttcgaactctgctacctccacttgtgt |
2018801 |
T |
 |
| Q |
615 |
gtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||| ||||||||||| ||||| |||||||||||||||| |
|
|
| T |
2018800 |
gtgtaagtttataatgactttgttatttcgtctatctacc |
2018761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 549 - 654
Target Start/End: Complemental strand, 14465926 - 14465824
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||| |||||||||||| ||||| ||||| |||||||||||||| |||||||||| ||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
14465926 |
aaaatgccaaaattgttaggctggatgtcatgatcggggttcgaaccctagtaccttcac---tgtgtgtgagtttataatgactttgtcatttcgtcta |
14465830 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
14465829 |
tctacc |
14465824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 521 - 623
Target Start/End: Complemental strand, 28594201 - 28594101
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||||||||| |||| ||||||||| | |||||||||||||||||||||||||| ||||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
28594201 |
tatccagaagtcctaactcaactggcaaaaggt--cgaaattgttaggccggatgccatgatcggggttcgaacctcggtacctccacttgtgtgtgtga |
28594104 |
T |
 |
| Q |
621 |
gtt |
623 |
Q |
| |
|
||| |
|
|
| T |
28594103 |
gtt |
28594101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 29479427 - 29479559
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||| || ||||| |||| ||||||||| || |||||||||||||| ||||| ||| |||||| ||||||||||| ||||| || || ||||||||| |
|
|
| T |
29479427 |
tatccataactcctaactcaactggcaaaa--tgtcgaaattgttaggctggatgtcataaccgggattcgaaccccgatacctccagttgtgtgtgtga |
29479524 |
T |
 |
| Q |
621 |
g-tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
29479525 |
gttttataatggctttgtcatttcgtctatctacc |
29479559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 549 - 654
Target Start/End: Complemental strand, 6453735 - 6453628
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg--agtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
|||||||||||||||| ||||| |||| |||||| |||| ||||||||||| ||| ||||| |||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
6453735 |
aaaatgccgaaattgtcaggcctgatgtcatgactagggtccgaaccccggttcctacacttgtgtgtgtgtgagtttgtaatggctttgccatttcgtc |
6453636 |
T |
 |
| Q |
647 |
tatctacc |
654 |
Q |
| |
|
|||||||| |
|
|
| T |
6453635 |
tatctacc |
6453628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 557 - 654
Target Start/End: Original strand, 25121860 - 25121959
Alignment:
| Q |
557 |
gaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgt--gtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||||||||||| ||||| ||||| | |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
25121860 |
gaaattgttaggccgaatgcaatgactagggttcgaaccccggtacctccacttgtgtgtgagagagtttataatggctttgtcatttcgtctatctacc |
25121959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 528 - 651
Target Start/End: Original strand, 34830783 - 34830904
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttata |
627 |
Q |
| |
|
||||||||||||| ||| | |||||||||||||||||||| |||||||||||||||| ||||||| |||||||||| |||| ||||| |||||||||| |
|
|
| T |
34830783 |
aagtcctagctcaactg--ataaaatgccgaaattgttaggtcggatgccatgaccggagttcgaagcccggtacctctacttgtgtgtatgagtttata |
34830880 |
T |
 |
| Q |
628 |
atggctttgccatttcgtctatct |
651 |
Q |
| |
|
||| |||| | || ||||||||| |
|
|
| T |
34830881 |
atgattttgtctttccgtctatct |
34830904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 549 - 628
Target Start/End: Complemental strand, 14982758 - 14982679
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataa |
628 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||| ||||||||||| ||||||| ||||| ||||||||||||||||| |
|
|
| T |
14982758 |
aaaataccgaaattgttaggccggatgccataaccgaggttcgaaccctggtacctccacttgtgtgtgtgagtttataa |
14982679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 550 - 653
Target Start/End: Complemental strand, 31242093 - 31241991
Alignment:
| Q |
550 |
aaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
||||| |||||||||||||||||| | ||||||||||||||||| |||| |||| |||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
31242093 |
aaatgtcgaaattgttaggccggacgtcatgaccggggttcgaatcccgacacctccactg-tgtgtgtgagtttatgatgactttgccatttcgtctat |
31241995 |
T |
 |
| Q |
650 |
ctac |
653 |
Q |
| |
|
|||| |
|
|
| T |
31241994 |
ctac |
31241991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 525 - 649
Target Start/End: Complemental strand, 30615038 - 30614918
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||| ||| |||||||| || |||||||||||||| |||||||||||| |||||||||| ||| ||||| |||| ||||||||||||| |
|
|
| T |
30615038 |
cagaagtcctagttcaattggcaaaa--tgtcgaaattgttaggctggatgccatgactggggttcgaattccgatacctccact--tgtgtgtgagttt |
30614943 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctat |
649 |
Q |
| |
|
|||||| ||||| |||||||||||| |
|
|
| T |
30614942 |
ataatgactttgtcatttcgtctat |
30614918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 549 - 653
Target Start/End: Complemental strand, 7974812 - 7974707
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccgggg-ttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
|||||||||||||||||||| |||| ||||| ||||| || |||||||| |||||||| || |||||||||||||||||||| |||| |||||||||| |
|
|
| T |
7974812 |
aaaatgccgaaattgttaggtcggacatcatgatcgggggtttgaaccccgataccttcagttgtgtgtgtgagtttataatggttttgtcatttcgtct |
7974713 |
T |
 |
| Q |
648 |
atctac |
653 |
Q |
| |
|
|||||| |
|
|
| T |
7974712 |
atctac |
7974707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 520 - 604
Target Start/End: Original strand, 16244408 - 16244490
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacct |
604 |
Q |
| |
|
|||| |||||||||||| ||| ||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
16244408 |
gtattcagaagtcctagatcaactggcaaaa--tgccgaaattgttaggctggatgccatgaccggggttcgaaccccagtacct |
16244490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 523 - 654
Target Start/End: Original strand, 2711304 - 2711433
Alignment:
| Q |
523 |
tccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagt |
622 |
Q |
| |
|
||||||||||||| |||| |||| |||| | |||||||||||||| |||| ||| |||| || ||||||||||| || ||| ||||| ||||||||| | |
|
|
| T |
2711304 |
tccagaagtcctaactcaactggtaaaata--ccgaaattgttaggtcggacgccttgacgggagttcgaacccccgtccctccacttgtgtgtgtgaat |
2711401 |
T |
 |
| Q |
623 |
ttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|| | ||||||||| ||||||||||||||||| |
|
|
| T |
2711402 |
tttttatggctttgtcatttcgtctatctacc |
2711433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 549 - 651
Target Start/End: Complemental strand, 31222737 - 31222635
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||| |||||||||| | |||||| ||||||| | |||||||||||||||||| |||||| |||||||| |||||||| | |||| |||||||| || |
|
|
| T |
31222737 |
aaaatgctgaaattgttaagtcggatgtcatgaccagagttcgaaccccggtacctccacttacgtgtgtgattttataatagttttgtcatttcgttta |
31222638 |
T |
 |
| Q |
649 |
tct |
651 |
Q |
| |
|
||| |
|
|
| T |
31222637 |
tct |
31222635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 549 - 649
Target Start/End: Original strand, 2746473 - 2746571
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||| ||||||||||||||||||| | || | ||||||||||||||||||| |||| |||||||||| |
|
|
| T |
2746473 |
aaaatgtcgaaattgttaggccggatgtcatgacaggggttcgaaccccggtacatcca--tttgtgtgtgagtttataatgactttattatttcgtcta |
2746570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 556 - 653
Target Start/End: Complemental strand, 9063073 - 9062976
Alignment:
| Q |
556 |
cgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||| || ||| | | |||| |||||||||||||| | ||| ||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9063073 |
cgaaattgttaagctggacgtcttgacgggggttcgaacccccgcccctccacttgtgtgtatgagtttataatggctttgccatttcgtctatctac |
9062976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 17546060 - 17546165
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| ||||||||||||| |||||| ||||| ||| ||| |||||||| || || |||||| ||||||||||||||||| |||| ||||||||||| |
|
|
| T |
17546060 |
aaaatgtcgaaattgttaggtcggatgtcatgatcggagtttgaaccccgatatctctacttatacgtgtgagtttataatggttttgtcatttcgtcta |
17546159 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
17546160 |
tctacc |
17546165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 528 - 652
Target Start/End: Complemental strand, 17210591 - 17210465
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaatt-gttaggccggatgccatgaccggggttcgaaccccggtaccttcactt--atgtgtgtgagttt |
624 |
Q |
| |
|
|||||||| |||| |||||||||| |||||| ||| ||||| ||||| | ||| |||||||||||||||||||||||| ||||| |||||| |||||| |
|
|
| T |
17210591 |
aagtcctaactcaactggcaaaaa-tgccgatatttgttagaccggacgtcataaccggggttcgaaccccggtacctccactttgttgtgtgcgagttt |
17210493 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|| |||| |||||||| || |||||||| |
|
|
| T |
17210492 |
attatggttttgccatatcttctatcta |
17210465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 547 - 652
Target Start/End: Original strand, 22721273 - 22721380
Alignment:
| Q |
547 |
aaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtg--tgtgagtttataatggctttgccatttcg |
644 |
Q |
| |
|
|||||||| |||||||||||||||||| | |||| ||||||| ||||||| |||| ||||| |||| ||||||||||||||| ||||| ||||||| |
|
|
| T |
22721273 |
aaaaaatgttgaaattgttaggccggatactatgatcggggttttaaccccgacacctccacttgtgtgtgtgtgagtttataatgactttgtcatttcg |
22721372 |
T |
 |
| Q |
645 |
tctatcta |
652 |
Q |
| |
|
|||||||| |
|
|
| T |
22721373 |
tctatcta |
22721380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 521 - 652
Target Start/End: Complemental strand, 31063076 - 31062948
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||||||||| |||| || | ||| |||||||||||||||||||||||| |||| ||| ||||||||||| || | ||| || ||| ||||| |
|
|
| T |
31063076 |
tatccagaagtcctacctcaacta--ataaagtgccgaaattgttaggccggatgctatgattgggattcgaaccccgatatc-tcaattgtgtatgtga |
31062980 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| |
|
|
| T |
31062979 |
gtttataatgactttatcatttcgtctatcta |
31062948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 525 - 647
Target Start/End: Complemental strand, 34182579 - 34182461
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
||||| ||||| |||||||||||||| |||||||||| ||||| |||||| ||| |||| ||||||| | ||||||||||||||||| ||||||||| |
|
|
| T |
34182579 |
cagaaatcctaactcagctggcaaaa--tgccgaaattattaggtcggatgtcataaccgaagttcgaatcgcggtaccttcacttatg--tgtgagttt |
34182484 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||| ||||| || ||||||| |
|
|
| T |
34182483 |
ataataactttgtcagttcgtct |
34182461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 549 - 653
Target Start/End: Original strand, 6615191 - 6615286
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||| |||||||||||||||| ||||| |||| ||||||||||||||||| |||||||| |||| |
|
|
| T |
6615191 |
aaaatgtcgaaattgttaggccagatgccatga-------tcgaaccccggtacctccactt--gtgtatgagtttataatggcttagccatttcatcta |
6615281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 549 - 653
Target Start/End: Complemental strand, 5015876 - 5015772
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||| |||||| |||||||||| | ||||| |||||||| ||| ||| |||||| | || ||||||| ||||||||||| |||| ||||||||| | |
|
|
| T |
5015876 |
aaaatgctgaaattattaggccggacgtcatgatcggggttccaactccgatacctttaattgtgtgtgttagtttataatgattttgtcatttcgtcaa |
5015777 |
T |
 |
| Q |
649 |
tctac |
653 |
Q |
| |
|
||||| |
|
|
| T |
5015776 |
tctac |
5015772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 556 - 653
Target Start/End: Original strand, 11548262 - 11548354
Alignment:
| Q |
556 |
cgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||| |||| | ||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11548262 |
cgaaattgttaggccggaccctatgaccggg-ttcgaatcccgatgcctctacttatgtgtgtgagtt----atggctttgccatttcgtctatctac |
11548354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 549 - 628
Target Start/End: Original strand, 3456501 - 3456580
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataa |
628 |
Q |
| |
|
|||||| | |||||||||||||| ||||| ||| | | ||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
3456501 |
aaaatgtcaaaattgttaggccgtatgccttgatcagaattcgaactccggtaccttcacttgtgtgtgtgagtttataa |
3456580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 522 - 592
Target Start/End: Original strand, 7098962 - 7099030
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcga |
592 |
Q |
| |
|
||||| || |||||||||| |||| ||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
7098962 |
atccacaactcctagctcaactgg--aaaaatgccgaaattgttaggccgggtgccatgatcggggttcga |
7099030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 548 - 649
Target Start/End: Complemental strand, 1266847 - 1266745
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttca-cttatgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||| ||||||||| ||| | |||||| || || ||||||||||||||| || | |||||||| || || |
|
|
| T |
1266847 |
aaaaatgccgaaattgttaggccggacgtcatgatcggggttcggacctcagtacctccattttgtgtgtgtgagtttatgatagttttgccatctcatc |
1266748 |
T |
 |
| Q |
647 |
tat |
649 |
Q |
| |
|
||| |
|
|
| T |
1266747 |
tat |
1266745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 548 - 654
Target Start/End: Original strand, 9297780 - 9297887
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggtt-cgaaccccggtaccttcactta-tgtgtgtgagtttataatggctttgccatttcgt |
645 |
Q |
| |
|
||||||| ||||||||||||||| || | ||||| |||||| ||||||| ||||||| ||||| ||||||||||||||| |||| |||||||| ||| |
|
|
| T |
9297780 |
aaaaatgtcgaaattgttaggccagacgtcatgattggggtttcgaaccc-ggtacctccactttgtgtgtgtgagtttatgatggttttgccatcccgt |
9297878 |
T |
 |
| Q |
646 |
ctatctacc |
654 |
Q |
| |
|
||||||||| |
|
|
| T |
9297879 |
ctatctacc |
9297887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 594 - 653
Target Start/End: Original strand, 26269291 - 26269350
Alignment:
| Q |
594 |
ccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||| |||||| ||||| | ||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
26269291 |
ccccagtacctccacttgtatgtgtgagtttataatggctttgtcattccgtctatctac |
26269350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 593 - 652
Target Start/End: Complemental strand, 29451738 - 29451679
Alignment:
| Q |
593 |
accccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||| |||| || ||||| ||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
29451738 |
accctggtatctccacttgtgtgtgtgagtttataatgactttgccatttcgtctttcta |
29451679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 607 - 652
Target Start/End: Original strand, 12473729 - 12473774
Alignment:
| Q |
607 |
acttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
12473729 |
acttatgtgtgtgagtttataatgattttgtcatttcgtctatcta |
12473774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 548 - 592
Target Start/End: Complemental strand, 8795514 - 8795470
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcga |
592 |
Q |
| |
|
||||||||||||||||||||||||| || |||||| ||||||||| |
|
|
| T |
8795514 |
aaaaatgccgaaattgttaggccgggtgtcatgacaggggttcga |
8795470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 526 - 596
Target Start/End: Original strand, 28322936 - 28323003
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
596 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| |||||||| | ||||| | |||||||||||| |
|
|
| T |
28322936 |
agaagtcctagctcaactggcaaa---tgccgaaattgtaaggccggacgtcatgatccgggttcgaaccc |
28323003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 526 - 596
Target Start/End: Original strand, 33621498 - 33621565
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
596 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| |||||||| | ||||||| |||||||||||| |
|
|
| T |
33621498 |
agaagtcctagctcaactggcaaa---tgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
33621565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 526 - 596
Target Start/End: Original strand, 33704220 - 33704287
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
596 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| |||||||| | ||||||| |||||||||||| |
|
|
| T |
33704220 |
agaagtcctagctcaactggcaaa---tgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
33704287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 622 - 653
Target Start/End: Original strand, 2675292 - 2675323
Alignment:
| Q |
622 |
tttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2675292 |
tttataatggctttgccatttcgtctatctac |
2675323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 549 - 642
Target Start/End: Original strand, 9329009 - 9329099
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccattt |
642 |
Q |
| |
|
|||||| ||||||||||| |||||| | |||| |||| ||||||| |||| |||| ||||||||||| ||||||||||| |||||||||| |
|
|
| T |
9329009 |
aaaatgtcgaaattgttatgccggacgttatgatcgggattcgaactccggcacctccacttatgtgt---agtttataatgattttgccattt |
9329099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 548 - 650
Target Start/End: Complemental strand, 10600347 - 10600244
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggct-ttgccatttcgtc |
646 |
Q |
| |
|
||||||| | ||||||||||||| | || |||||||||||| ||||||| | ||| |||| | ||||||||||| ||||| || ||||||||||||| |
|
|
| T |
10600347 |
aaaaatgtcaaaattgttaggccaaacgctgtgaccggggttcaaaccccgattcctctacttgtatgtgtgagtttctaatgactcttgccatttcgtc |
10600248 |
T |
 |
| Q |
647 |
tatc |
650 |
Q |
| |
|
|||| |
|
|
| T |
10600247 |
tatc |
10600244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 548 - 626
Target Start/End: Original strand, 19700312 - 19700390
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttat |
626 |
Q |
| |
|
|||||||||||||||||||||||| || ||||| ||||||| ||| ||| ||| ||||| ||||||||||||||| |
|
|
| T |
19700312 |
aaaaatgccgaaattgttaggccgagcgcaatgactggggttcaaacaccgacaccgccacttgtgtgtgtgagtttat |
19700390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 552 - 653
Target Start/End: Complemental strand, 31340581 - 31340483
Alignment:
| Q |
552 |
atgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatct |
651 |
Q |
| |
|
||||||||||||||||||| ||| | |||||| | ||| ||| || |||| | |||||| | ||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
31340581 |
atgccgaaattgttaggcc-gatactatgacctgaattcaaactccagtacttccactta--tatgtgagtttataatggctttgtcatttcgtcaatct |
31340485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 549 - 650
Target Start/End: Complemental strand, 31642790 - 31642691
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||||||| |||| || ||||| ||||| ||||| || ||| ||||| ||| |||||||||||| | ||||| ||||||||||| |
|
|
| T |
31642790 |
aaaatgccgaaattgttaggtcggacgctttgacccgggtttgaacctcgatactatcact--tgtatgtgagtttatattaactttgtcatttcgtcta |
31642693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 111; Significance: 1e-55; HSPs: 179)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 1e-55
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 8381077 - 8381208
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
8381077 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
8381174 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8381175 |
gtttataatggctttgccatttcgtctatctacc |
8381208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 111; E-Value: 1e-55
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 13525167 - 13525298
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
13525167 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
13525264 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
13525265 |
gtttataatggctttgccatttcgtctatctacc |
13525298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 110; E-Value: 5e-55
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 4232306 - 4232176
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
4232306 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
4232209 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4232208 |
tttataatggctttgccatttcgtctatctacc |
4232176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 107; E-Value: 3e-53
Query Start/End: Original strand, 520 - 654
Target Start/End: Complemental strand, 28171111 - 28170978
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |||||||| |
|
|
| T |
28171111 |
gtatccagaagtcctagctcaactggcaaaaa-tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggcacctctacttgtgtgtgtg |
28171013 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
28171012 |
agtttataatggctttgccatttcgtctatctacc |
28170978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 106; E-Value: 1e-52
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 3917765 - 3917895
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
3917765 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
3917862 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
3917863 |
tttataatggctttgccatttcgtctatctacc |
3917895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 106; E-Value: 1e-52
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 4833238 - 4833108
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4833238 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttgtgtgtgtgag |
4833141 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| |
|
|
| T |
4833140 |
tttataatggctttgccaatttgtctatctacc |
4833108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 106; E-Value: 1e-52
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 32961107 - 32960977
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
32961107 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccagatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
32961010 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
32961009 |
tttataatggctttgccatttcgtctatctacc |
32960977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 106; E-Value: 1e-52
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 47069004 - 47069136
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||| ||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
47069004 |
tatccagaagtcttagctcaactggcaaaa-atgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
47069102 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
47069103 |
gtttataatggttttgccatttcgtctatctacc |
47069136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 104; E-Value: 2e-51
Query Start/End: Original strand, 520 - 654
Target Start/End: Original strand, 8507929 - 8508061
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
||||||||||||| ||||||| |||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
8507929 |
gtatccagaagtcttagctcaactgg--aaaaatgccgaaattgttaggccggatgccatgactggggttcaaaccccggtacctccacttatgtgtgtg |
8508026 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
8508027 |
agtttataatggctttgccatttcgtctatctacc |
8508061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 103; E-Value: 8e-51
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 4976838 - 4976707
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| | |
|
|
| T |
4976838 |
tatccagaagtcctagctcaactggcaaaa--tgccaaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtta |
4976741 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
4976740 |
gtttataatggctttgccatttcgtctatctacc |
4976707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 101; E-Value: 1e-49
Query Start/End: Original strand, 534 - 654
Target Start/End: Original strand, 3440736 - 3440855
Alignment:
| Q |
534 |
tagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggct |
633 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
3440736 |
tagctcaactggcaaaa-atgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggct |
3440834 |
T |
 |
| Q |
634 |
ttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3440835 |
ttgccatttcgtctatctacc |
3440855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 101; E-Value: 1e-49
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 11029662 - 11029793
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| |||||||||| || |||||||||||||| ||||||||||||| |||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
11029662 |
atccagaagtcctagctcaactggcaaaaa-tgtcgaaattgttaggctggatgccatgaccagggttcgaaccccggtacctccacttgtgtgtgtgag |
11029760 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
11029761 |
tttataatggctttgccatttcgtctatctacc |
11029793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 100; E-Value: 5e-49
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 24650677 - 24650545
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||||||||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
24650677 |
tatccagaagtcctacctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
24650580 |
T |
 |
| Q |
621 |
g-tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24650579 |
gttttataatggctttgccatttcgtctatctacc |
24650545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 98; E-Value: 8e-48
Query Start/End: Original strand, 526 - 654
Target Start/End: Original strand, 1242220 - 1242346
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||| |||||||||||||||||| |||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
1242220 |
agaagtcctagctcaactggcaaaa--tgccgaaattattaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttta |
1242317 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1242318 |
taatggctttgccatttcgtctatctacc |
1242346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 98; E-Value: 8e-48
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 29212195 - 29212062
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcact--tatgtgtgt |
618 |
Q |
| |
|
|||||| ||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | ||||||| |
|
|
| T |
29212195 |
tatccataagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgt |
29212098 |
T |
 |
| Q |
619 |
gagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
29212097 |
gagtttataatggctttgccatttcgtctatctacc |
29212062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 98; E-Value: 8e-48
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 38127971 - 38127841
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| || ||||||||||||||||||||| ||||||||||||||||||||||| ||| ||||| |||||||||| |
|
|
| T |
38127971 |
atccagaagtcctagctcaactggcaaaa--tgtcgaaattgttaggccggatgctatgaccggggttcgaaccccggttcctccacttgtgtgtgtgag |
38127874 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38127873 |
tttataatggctttgccatttcgtctatctacc |
38127841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 98; E-Value: 8e-48
Query Start/End: Original strand, 521 - 649
Target Start/End: Complemental strand, 46838857 - 46838731
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| ||||||||| |
|
|
| T |
46838857 |
tatccagaagtcctagctcaactgg--aaaaatgccgaaattgttaggccggatgccatgaccggggctcgaactccggtaccttcacttgtgtgtgtga |
46838760 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
||||||||||||||| ||||||||||||| |
|
|
| T |
46838759 |
gtttataatggctttcccatttcgtctat |
46838731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 96; E-Value: 1e-46
Query Start/End: Original strand, 528 - 654
Target Start/End: Complemental strand, 10474037 - 10473913
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttata |
627 |
Q |
| |
|
||||||||||||| ||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
10474037 |
aagtcctagctcaactggcaaaa--tgctgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttata |
10473940 |
T |
 |
| Q |
628 |
atggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||| |||||||||| |
|
|
| T |
10473939 |
atggctttgccatttcatctatctacc |
10473913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 14868983 - 14868854
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||| |||| |||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
14868983 |
atccagaagtcctagctcaactggcaaa---tgccgaaattgttaggctggataccatgaccggggtttgaaccccggtacctccacttatgtgtgtgaa |
14868887 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
14868886 |
tttataatggctttgccatttcgtctatctacc |
14868854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 15003626 - 15003757
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| |||| ||||||||||| |||||| |||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
15003626 |
tatccagaagtcctagttcaactggcaaaa--tgccaaaattgttaggtcggatgtcatgaccggggttcgaaccccggtacctccacctatgtgtgtga |
15003723 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
15003724 |
gtttataatggctttgccatttcgtctatctacc |
15003757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 24910418 - 24910287
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||| |||| ||||| |||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
24910418 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggctggatatcatgatcggggttcgaaccccggtacctccacttgtgtgtgtga |
24910321 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
24910320 |
gtttataatggctttgccatttcgtctatctacc |
24910287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 34397678 - 34397809
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| ||||||||||||||||||||||| ||| |||||||||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
34397678 |
tatccagaagtcctagttcaactggcaaaa--tgccgaaattgttaggccggatgtcataaccggggttcgaaccccgatacctccacttgtgtgtgtga |
34397775 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
34397776 |
gtttataatggctttgccatttcgtctatctacc |
34397809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 43605705 - 43605574
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||| ||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
43605705 |
atccagaagtcctagctcaactggcaaaa--tgctgaatttgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
43605608 |
T |
 |
| Q |
622 |
-tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43605607 |
ttttataatggctttgccatttcgtctatctacc |
43605574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 41464662 - 41464795
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcact--tatgtgtgt |
618 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |||||| |||| | ||||||| |
|
|
| T |
41464662 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggtcggatgccatgaccggggttcgaaccccagtacctccacttgtgtgtgtgt |
41464759 |
T |
 |
| Q |
619 |
gagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
41464760 |
gagtttataatggctttgccatttcgtctatctacc |
41464795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 46894812 - 46894942
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||| ||||| || ||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46894812 |
atccagaagtcctagctcaactgacaaaatat--cgaaattgttaggccggatgccatgaccgaggttcgaaccccgataccttcacttatgtgtgtgag |
46894909 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||| |
|
|
| T |
46894910 |
tttatattggcttttccatttcgtctatctacc |
46894942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 47410881 - 47410751
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| || ||||||||||||| |||||| |||||||||||||||||||| ||||||| ||||| |||||||||| |
|
|
| T |
47410881 |
atccagaagtcctagctcaactggcaaaa--tgtcgaaattgttaggtcggatgtcatgaccggggttcgaaccctggtacctccacttgtgtgtgtgag |
47410784 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
47410783 |
tttataatggctttgccatttcgtctatctacc |
47410751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 93; E-Value: 8e-45
Query Start/End: Original strand, 550 - 654
Target Start/End: Complemental strand, 8128393 - 8128289
Alignment:
| Q |
550 |
aaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8128393 |
aaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtctat |
8128294 |
T |
 |
| Q |
650 |
ctacc |
654 |
Q |
| |
|
||||| |
|
|
| T |
8128293 |
ctacc |
8128289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 93; E-Value: 8e-45
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 9583553 - 9583422
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||| | ||||||| |||||||||| |||||||||||||||||||||||| |||||||||||| |||||||| ||||| ||||| |||||||||| |
|
|
| T |
9583553 |
atccagaagccttagctcaactggcaaaaa-tgccgaaattgttaggccggatgctatgaccggggttagaaccccgatacctccacttgtgtgtgtgag |
9583455 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
9583454 |
tttataatggctttgccatttcgtctatctacc |
9583422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 93; E-Value: 8e-45
Query Start/End: Original strand, 526 - 654
Target Start/End: Original strand, 40840171 - 40840298
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| | | || |
|
|
| T |
40840171 |
agaagtcctagctcaactggcaaaa-atgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgagtttata |
40840269 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40840270 |
taatggctttgccatttcgtctatctacc |
40840298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 92; E-Value: 3e-44
Query Start/End: Original strand, 517 - 654
Target Start/End: Complemental strand, 6583369 - 6583233
Alignment:
| Q |
517 |
atagtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgt |
616 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| ||| ||||| ||||| |
|
|
| T |
6583369 |
atagcatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtgcctccacttgtgtgt |
6583272 |
T |
 |
| Q |
617 |
gtgag-tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
6583271 |
gtgagttttattatggctttgccatttcgtctatctacc |
6583233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 92; E-Value: 3e-44
Query Start/End: Original strand, 522 - 652
Target Start/End: Complemental strand, 54097569 - 54097442
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| ||| ||||| |||||||||| |
|
|
| T |
54097569 |
atccagaagtcctagctcaaatggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttggaaccccggt-cctccacttgtgtgtgtgag |
54097473 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
54097472 |
tttataatggctttgccatttcgtctatcta |
54097442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 91; E-Value: 1e-43
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 10047870 - 10048001
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||| |||| |||||||||||||| ||||||||||||||||||||||||||| | ||||||||||||| ||||||||| |
|
|
| T |
10047870 |
tatccagaagtcctagctcaattggtaaaa--tgccgaaattgttatgccggatgccatgaccggggttcgaactctggtaccttcacttgtgtgtgtga |
10047967 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
10047968 |
gtttataatggctttgccatttcgcctatctacc |
10048001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 10228956 - 10229086
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||| || |||| ||||||||| |||| |||||||||||||| ||| |||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
10228956 |
atccagaagtcttaactcaactggcaaaa--tgccaaaattgttaggccgaatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
10229053 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
10229054 |
tttataatggctttgccatttcgtctatctacc |
10229086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 27396853 - 27396982
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||| ||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |||||||||| |
|
|
| T |
27396853 |
atccagaagtcctagctcaactgacaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaa-cccggtacctccacttgtgtgtgtgag |
27396949 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| |||||||||||| |||||||||| |
|
|
| T |
27396950 |
tttataatgactttgccatttcttctatctacc |
27396982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 549 - 654
Target Start/End: Complemental strand, 28197088 - 28196983
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28197088 |
aaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgcaatttcgtcta |
28196989 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
28196988 |
tctacc |
28196983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 43898092 - 43897962
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| | | ||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |||||||||| |
|
|
| T |
43898092 |
atccagaagtcctagctcaacagacaaaa--tgccgaaattgttaggccggatgccatgaccgggattcgaaccccggtacctccacttgtgtgtgtgag |
43897995 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||| |
|
|
| T |
43897994 |
tttacaatgactttgccatttcgtctatctacc |
43897962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 526 - 654
Target Start/End: Original strand, 11312593 - 11312721
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg--agtt |
623 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |||||||| |||| |
|
|
| T |
11312593 |
agaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgctatgaccggggttcgaaccccggtacctccacttgtgtgtgtgtcagtt |
11312690 |
T |
 |
| Q |
624 |
tataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |
|
|
| T |
11312691 |
tataatggcattgccatttcgtctatctacc |
11312721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 520 - 654
Target Start/End: Original strand, 24250722 - 24250855
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |||||| || |||||||| |
|
|
| T |
24250722 |
gtatccagaagtcctagctcaattggcaaaa--tgccgaaattgttaggccggatgctatgaccggggttcgaaccccggtgccttcatttgtgtgtgtg |
24250819 |
T |
 |
| Q |
620 |
ag-tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
24250820 |
agttttataatggctttgtcatttcgtctatctacc |
24250855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 550 - 654
Target Start/End: Original strand, 35240055 - 35240159
Alignment:
| Q |
550 |
aaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35240055 |
aaatgccgaaattgttaggccggatgccttgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttcataatggctttgccatttcgtctat |
35240154 |
T |
 |
| Q |
650 |
ctacc |
654 |
Q |
| |
|
||||| |
|
|
| T |
35240155 |
ctacc |
35240159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 526 - 654
Target Start/End: Complemental strand, 52256878 - 52256751
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
|||||| |||||||| |||||||||| || ||| |||||||||| |||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
52256878 |
agaagttctagctcaactggcaaaaa-tgtcgatattgttaggctggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttta |
52256780 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||| ||||||||||||||||||||||| |
|
|
| T |
52256779 |
taatgactttgccatttcgtctatctacc |
52256751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 88; E-Value: 7e-42
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 28266524 - 28266656
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||| ||||| ||||||||||||||||| |||||||||||||||||||||||| ||||| ||| ||||| ||||||||| |
|
|
| T |
28266524 |
tatccagaagtcctagctcaactgacaaaa--tgccgaaattgttaggctggatgccatgaccggggttcgaactccggtgcctccacttgtgtgtgtga |
28266621 |
T |
 |
| Q |
621 |
g-tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28266622 |
gttttataatggctttgccatttcgtctatctacc |
28266656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 2789108 - 2788978
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| |||||||||| ||||||| ||||||||||||||||||||||||||||||||| ||||| ||| ||||| |
|
|
| T |
2789108 |
tatccagaagtcctagttcaactggcaaaa--tgccgaaattattaggcctgatgccatgaccggggttcgaaccccggtacctccacttgtgt-tgtga |
2789012 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
2789011 |
gtttataatggctttgccatttcatctatctacc |
2788978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 5998909 - 5998781
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||| |||| ||||||||||||||||| | || ||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
5998909 |
atccagaagtcctagctcatctgacaaa---tgccgaaattgttaggctg-ataccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
5998814 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
5998813 |
tttataatggctttgccatttcgtctatctacc |
5998781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 32590970 - 32591101
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| |||| |||| || |||||||||||||||||||||||||| ||||||||||| |||||||||| ||||| ||||||| | |
|
|
| T |
32590970 |
tatccagaagtcctagctcaactggtaaaa--tgtcgaaattgttaggccggatgccatgatcggggttcgaatcccggtacctccacttgtgtgtgtca |
32591067 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
32591068 |
gtttataatggctttgccattccgtctatctacc |
32591101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 549 - 653
Target Start/End: Original strand, 9609956 - 9610061
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag-tttataatggctttgccatttcgtct |
647 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9609956 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcctccacttgtgtgtgtgagttttataatggctttgccatttcgtct |
9610055 |
T |
 |
| Q |
648 |
atctac |
653 |
Q |
| |
|
|||||| |
|
|
| T |
9610056 |
atctac |
9610061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 35359741 - 35359846
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
35359741 |
aaaatgccgaaattgttaggccggatgccatgaccagggttcgaaccccggtacctccacttgtgtgtgtgagtttataatgactttgtcatttcgtcta |
35359840 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
35359841 |
tctacc |
35359846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 48555835 - 48555965
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| |||||||| |||| ||||||||| |||| ||||||||||||| ||||| ||| ||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
48555835 |
atccataagtcctacctcaactggcaaaa--tgccaaaattgttaggccagatgctatggccggggttcgaaccccggtacctccacttgtgtgtgtgag |
48555932 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
48555933 |
tttataatggctttgccatttcgtctatctacc |
48555965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 85; E-Value: 5e-40
Query Start/End: Original strand, 522 - 653
Target Start/End: Complemental strand, 27002869 - 27002740
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||||||||| |||||||||||||||| | |||||||||||||||||| ||||| |||||||||| |
|
|
| T |
27002869 |
atccagaagtcctagctcaactggcaaag--tgccgaaattgttaagccggatgccatgaccagagttcgaaccccggtacctccacttgtgtgtgtgag |
27002772 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||| |||| |||||||||||||||| |
|
|
| T |
27002771 |
tttataatggttttgtcatttcgtctatctac |
27002740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 85; E-Value: 5e-40
Query Start/End: Original strand, 521 - 651
Target Start/End: Original strand, 42296710 - 42296837
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| |||||||||||||||||| |||||||||||||||||||||||||||| ||||| |||||| || |
|
|
| T |
42296710 |
tatccagaagtcctagctcaactgc---aaaatgccaaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgaga |
42296806 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatct |
651 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42296807 |
atttataatggctttgccatttcgtctatct |
42296837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 522 - 652
Target Start/End: Original strand, 17500926 - 17501054
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
|||||||||||||| |||| |||| |||||||||||||||||||||||||||||||||||||||||||||| || ||| | ||||| |||||||||| |
|
|
| T |
17500926 |
atccagaagtcctaactcaactgg--aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaaccaaatacatccacttgtgtgtgtgag |
17501023 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
17501024 |
tttataatggctttgccatttcgtctatcta |
17501054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 547 - 650
Target Start/End: Original strand, 43426590 - 43426693
Alignment:
| Q |
547 |
aaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||| |||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43426590 |
aaaaaatgccgaaattgttaggtcagatgccatgaccggagttcgaaccccggtacctccacttatgtgtatgagtttataatggctttgccatttcgtc |
43426689 |
T |
 |
| Q |
647 |
tatc |
650 |
Q |
| |
|
|||| |
|
|
| T |
43426690 |
tatc |
43426693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 551 - 654
Target Start/End: Complemental strand, 2096687 - 2096582
Alignment:
| Q |
551 |
aatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcact--tatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2096687 |
aatgccgaaattgttaggctggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgtgagtttataatggctttgccatttcgtcta |
2096588 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
2096587 |
tctacc |
2096582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 520 - 653
Target Start/End: Complemental strand, 12088413 - 12088282
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
||||||||||||||||| ||| ||| ||||||| ||||||||||||||||||||| |||| |||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
12088413 |
gtatccagaagtcctagatcacttgg--aaaaatgtcgaaattgttaggccggatgctatgatcggggttcgaaccccggtacctccacttgtgtgtgtg |
12088316 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| |
|
|
| T |
12088315 |
agtttataatggatttgtcatttcgtctatctac |
12088282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 519 - 652
Target Start/End: Complemental strand, 19921444 - 19921313
Alignment:
| Q |
519 |
agtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgt |
618 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||| |||||||||||| ||||||||||||| | |||||||||||| || ||| ||||||||||||| |
|
|
| T |
19921444 |
agtatccagaagtcctagctcaattggcaaaa--tgctgaaattgttaggtcggatgccatgactgaggttcgaaccccagttcctccacttatgtgtgt |
19921347 |
T |
 |
| Q |
619 |
gagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
19921346 |
gagtttataatgactttgccatttcgtctatcta |
19921313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 30553098 - 30552968
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||| ||||||||||||||||| |||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
30553098 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttagaccggatgccatgaccggagttcgaaccccgatacctccacttgtgtgtgtga |
30553001 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||||| |
|
|
| T |
30553000 |
gtttataatggc-ttgctatttcatctatctacc |
30552968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 40559672 - 40559803
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||| | |||||||||||||||||||| |||||||| ||| |||||||||||| ||| ||||| ||||| ||||||||| |
|
|
| T |
40559672 |
tatccagaagtcctagctcaactg--ataaaatgccgaaattgttaggtcggatgccttgatcggggttcgaactccgatacctccacttgtgtgtgtga |
40559769 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
40559770 |
gtttataatggctttgtcatttcgtctatctacc |
40559803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 521 - 653
Target Start/End: Complemental strand, 6083271 - 6083142
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| || |||||| |||||||||||||||||||||| ||||||||||| ||||||| ||||||||| ||||| ||||||||| |
|
|
| T |
6083271 |
tatccagaagtcctagctcaactagcaaaa--tgccgaaattgttaggccggataccatgaccggg-ttcgaactccggtacctccacttgtgtgtgtga |
6083175 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||| |||| |||||||||||||||| |
|
|
| T |
6083174 |
gtttataatggttttgtcatttcgtctatctac |
6083142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 22371449 - 22371578
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
|||||||||||||| |||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| | || ||| || || ||||||| || |
|
|
| T |
22371449 |
atccagaagtcctacctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccacagt-cctccatttgtgtgtgtaag |
22371545 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
22371546 |
tttataatggctttgccatttcgtctatctacc |
22371578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 24657410 - 24657540
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
|||||||||||||| |||| ||| ||||| ||||||||||||||||| |||||||||| || |||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
24657410 |
atccagaagtcctaactcaactgacaaaa--tgccgaaattgttaggcaggatgccatggccagggttcgaaccccggtacctccacttgtgtgtgtgag |
24657507 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |
|
|
| T |
24657508 |
cttataatggttttgccatttcgtctatctacc |
24657540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 24751752 - 24751882
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| ||||||||||||| ||||||||| ||||||||||||||||||||||| ||||| |||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
24751752 |
atccacaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgatcggggttcgaaccctggtaccttcacttgtgtgtgtgaa |
24751849 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||| |||||| ||| |||||| |
|
|
| T |
24751850 |
tttataatggctttgtcatttcatctgtctacc |
24751882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 35069311 - 35069444
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcact--tatgtgtgt |
618 |
Q |
| |
|
|||| ||||||| ||| ||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | ||||||| |
|
|
| T |
35069311 |
tatcaagaagtcttagttcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgt |
35069408 |
T |
 |
| Q |
619 |
gagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||| |
|
|
| T |
35069409 |
gagtttataatggctttgtcatttcatctatctacc |
35069444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 521 - 653
Target Start/End: Original strand, 30703088 - 30703219
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||| ||||||||||||||| ||||||||| | |||||||||||||| ||||| |||||||||||||||||||||| ||||| ||||| |||||| || |
|
|
| T |
30703088 |
tatcgagaagtcctagctcaattggcaaaaa-tatcgaaattgttaggctggatgtcatgaccggggttcgaaccccgttacctccacttgtgtgtgaga |
30703186 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30703187 |
gtttataatggctttgccatttcgtctatctac |
30703219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 525 - 652
Target Start/End: Complemental strand, 50238966 - 50238841
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| |||| |||| || |||||||||||||||||||||||||| ||| |||||||| ||||||||| ||||| ||||||||||||| |
|
|
| T |
50238966 |
cagaagtcctagctcaactggtaaaa--tgtcgaaattgttaggccggatgccatgatcggagttcgaactccggtacctccacttgtgtgtgtgagttt |
50238869 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||| |||||||||||||||||||| |
|
|
| T |
50238868 |
ataatggttttgccatttcgtctatcta |
50238841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 7552619 - 7552722
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7552619 |
aaaataccgaaattgttaggccggatgccgtgaccggggttcgaaccccaatacctccacttgtgtgtgtgagtttataatggctttgccatttcgtcta |
7552718 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
7552719 |
tcta |
7552722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 522 - 650
Target Start/End: Original strand, 11751210 - 11751338
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcact--tatgtgtgtg |
619 |
Q |
| |
|
||||| ||||||||||||| ||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| | |||||||| |
|
|
| T |
11751210 |
atccataagtcctagctcaactggcaaaa-atgccgaaattgttaggccggatgccatcaccggggttcgaaccccggtacctccacttgtgtgtgtgtg |
11751308 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatc |
650 |
Q |
| |
|
|||||||||||| |||| ||||||||||||| |
|
|
| T |
11751309 |
agtttataatgg-tttgtcatttcgtctatc |
11751338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 549 - 652
Target Start/End: Complemental strand, 33886474 - 33886371
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |||||||||||||| | |
|
|
| T |
33886474 |
aaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggttttgccatttcgtcaa |
33886375 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
33886374 |
tcta |
33886371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 548 - 649
Target Start/End: Original strand, 1562818 - 1562917
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1562818 |
aaaaatgccgaaattgttaggtcggatgtcatgatcggggttcgaaccccggtaccttcact--tgtgtgtgagtttataatggctttgccatttcgtct |
1562915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 78; E-Value: 7e-36
Query Start/End: Original strand, 530 - 654
Target Start/End: Original strand, 2558754 - 2558876
Alignment:
| Q |
530 |
gtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataat |
629 |
Q |
| |
|
||||||||||| ||||||||| ||| |||||||||||| |||||| ||||| ||||||| |||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
2558754 |
gtcctagctcaactggcaaaa--tgctgaaattgttaggtcggatgtcatgatcggggtttgaaccccgatacctccacttatgtgtgtgagtttataat |
2558851 |
T |
 |
| Q |
630 |
ggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||| ||||| |
|
|
| T |
2558852 |
ggctttgccatttcgtctacctacc |
2558876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 78; E-Value: 7e-36
Query Start/End: Original strand, 525 - 653
Target Start/End: Original strand, 48191096 - 48191222
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| ||| |||| ||||||||||||||||||||||| |||||||||||||||||| || |||||| ||||| ||||||||||||| |
|
|
| T |
48191096 |
cagaagtcctagctcaactgctaaaa--tgccgaaattgttaggccggatgtcatgaccggggttcgaactccagtacctccacttgtgtgtgtgagttt |
48191193 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||| |||| |||||||||||||||| |
|
|
| T |
48191194 |
ataatggttttgtcatttcgtctatctac |
48191222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 521 - 652
Target Start/End: Complemental strand, 8792860 - 8792732
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| | || ||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||| |||||| |||||||| |
|
|
| T |
8792860 |
tatccagaagtcctagctcaaccggtaaaaa-tgccgaaattgttaggctggatgccatgattggggttcgaaccccggtacattcact--tgtgtgtgg |
8792764 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |
|
|
| T |
8792763 |
gtttataatagctttgccatttcgtctatcta |
8792732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 521 - 652
Target Start/End: Complemental strand, 24274010 - 24273881
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||| |||||||||| |||| ||| ||||| |||||||||||||||||||||||||||||| |||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
24274010 |
tatctagaagtcctaactcaactgacaaaa--tgccgaaattgttaggccggatgccatgactagggttcgaacttcggtacctccacttgtgtgtgtga |
24273913 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |
|
|
| T |
24273912 |
gtttataatggctttgccatttcgtctttcta |
24273881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 522 - 652
Target Start/End: Original strand, 37124215 - 37124344
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||| |||||| ||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |||||||| | ||| |||||||||| |
|
|
| T |
37124215 |
atccagaagtcatagctctactggcaaaa--tgccgaaattgttaggccgaatgccatgaccggggttcgaacctcggtacctccccttgtgtgtgtgag |
37124312 |
T |
 |
| Q |
622 |
-tttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |
|
|
| T |
37124313 |
ttttataatgactttgccatttcgtctatcta |
37124344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 8826623 - 8826755
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| | | ||||| ||||||||||||||| |||||||| |||| ||||| |||||||||||||||| ||||| ||||||||| |
|
|
| T |
8826623 |
tatccagaagtcctagctcaacggacaaaa--tgccgaaattgttagaccggatgctatgatcggggctcgaaccccggtacctccacttgtgtgtgtga |
8826720 |
T |
 |
| Q |
621 |
g-tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
8826721 |
gttttataatgactttgccatttcgtctatctacc |
8826755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 553 - 652
Target Start/End: Complemental strand, 34481892 - 34481793
Alignment:
| Q |
553 |
tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34481892 |
tgccgaaattgttaggccggatgacatgaccggggttcgaacttcggtacctctacttgtgtgtgtgagtttataatggctttgccatttcgtctatcta |
34481793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 525 - 652
Target Start/End: Complemental strand, 43904622 - 43904496
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
||||||| |||||||| ||| |||||||| ||||||||||||||||||||||||||||||||||| ||||| ||||||| || |||||||||||||||| |
|
|
| T |
43904622 |
cagaagttctagctcaactga-aaaaaatgtcgaaattgttaggccggatgccatgaccggggttcaaaccctggtacctccatttatgtgtgtgagttt |
43904524 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||| ||||| ||||||||||||||| |
|
|
| T |
43904523 |
ataataactttgtcatttcgtctatcta |
43904496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 549 - 652
Target Start/End: Complemental strand, 53669815 - 53669712
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| || |||||||||||||| |||||| || |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
53669815 |
aaaatgctgaaattgttaggccggatgccatgactggagttcgaaccccggttccttcatttgtgtgtgtgagtttataatggctttgccatttcatcta |
53669716 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
53669715 |
tcta |
53669712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 17373669 - 17373800
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||| ||||| |||||||||||| |||| |||||||||||||| ||||||||||||||| | ||||||||| ||| ||||| ||||| ||||||||| |
|
|
| T |
17373669 |
tatccacaagtcttagctcagctggtaaaa--tgccgaaattgttaagccggatgccatgactgaggttcgaactccgctacctccacttgtgtgtgtga |
17373766 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
17373767 |
atttataatggctttgccatttcgtctatttacc |
17373800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 523 - 652
Target Start/End: Original strand, 37312528 - 37312655
Alignment:
| Q |
523 |
tccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagt |
622 |
Q |
| |
|
|||||||||||||||||| |||| |||| | ||||||||||||||||||| ||| |||| |||||||||||||| | ||| ||||| ||||||||||| |
|
|
| T |
37312528 |
tccagaagtcctagctcaactggtaaaata--ccgaaattgttaggccggacgccttgacgggggttcgaacccccgcccctccacttgtgtgtgtgagt |
37312625 |
T |
 |
| Q |
623 |
ttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37312626 |
ttataatggctttgccatttcgtctatcta |
37312655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 44037573 - 44037443
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||| |||||| | ||| || |||||||| |||||||||| ||||||||||||||| |
|
|
| T |
44037573 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggtcggatgtcgtgatcgaggttcgaatcccggtacctctacttatgtgtgtgag |
44037476 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||| |||| |||||| |||||||||| |
|
|
| T |
44037475 |
tttataatggttttgtcatttcatctatctacc |
44037443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 73; E-Value: 7e-33
Query Start/End: Original strand, 519 - 654
Target Start/End: Complemental strand, 25118838 - 25118705
Alignment:
| Q |
519 |
agtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgt |
618 |
Q |
| |
|
|||||| ||||||| ||||||| || |||||| || |||||||||||||||||||||||||||| |||||||||||||||||||| ||| | ||||||| |
|
|
| T |
25118838 |
agtatctagaagtcttagctcaactagcaaaa--tgtcgaaattgttaggccggatgccatgaccagggttcgaaccccggtacctccacctgtgtgtgt |
25118741 |
T |
 |
| Q |
619 |
gagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|| ||||||||| |||| ||||||||||||||||| |
|
|
| T |
25118740 |
gaatttataatgattttgtcatttcgtctatctacc |
25118705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 73; E-Value: 7e-33
Query Start/End: Original strand, 521 - 652
Target Start/End: Original strand, 28731845 - 28731974
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||| |||||| |||||||| ||| ||||| || ||||||||||||| |||||||||||| ||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
28731845 |
tatctagaagttctagctcaactgacaaaa--tgtcgaaattgttaggtcggatgccatgatcggggttcgaatcccggtaccttcacttgtgtgtgtga |
28731942 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||| |||| ||||| ||||||||||||||| |
|
|
| T |
28731943 |
gtttacaatgactttgtcatttcgtctatcta |
28731974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 73; E-Value: 7e-33
Query Start/End: Original strand, 525 - 654
Target Start/End: Complemental strand, 51112589 - 51112465
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||| ||||||||| | ||||||||||||||||||||| || || ||||| |||||||||||| |
|
|
| T |
51112589 |
cagaagtcctagctcaactggcaaa---tgccgaaattgctaggccggacgtcatgaccggggttcgaaccccagtgcccccactt--gtgtgtgagttt |
51112495 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
51112494 |
ataatggctttgccatttcgtctatctacc |
51112465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 525 - 652
Target Start/End: Original strand, 9493499 - 9493625
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| || | | |||||| |||||||||||||| |||||||||||| ||||||||||||||||||||| ||||| | ||||||||||| |
|
|
| T |
9493499 |
cagaagtcctagctcaacttg-ataaaatgtcgaaattgttaggctggatgccatgactggggttcgaaccccggtacctccacttgtatgtgtgagttt |
9493597 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||| ||||| |||||||| |||||| |
|
|
| T |
9493598 |
ataatgactttgtcatttcgtatatcta |
9493625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 525 - 653
Target Start/End: Original strand, 12948812 - 12948937
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag-tt |
623 |
Q |
| |
|
|||||||||||||||| |||| |||| || |||||||||||||||||||||||||| |||||||||||||||| ||| | |||| |||||||||| || |
|
|
| T |
12948812 |
cagaagtcctagctcaactggtaaaa--tgacgaaattgttaggccggatgccatgatcggggttcgaaccccgatacttccact--tgtgtgtgagttt |
12948907 |
T |
 |
| Q |
624 |
tataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12948908 |
tataatggctttgccatttcgtctatctac |
12948937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 16135026 - 16135129
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||||||| |||||| || || |||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
16135026 |
aaaatgccgaaattgttaggtcggatgtcaagatcggggttcgaaccccgctacctccacttatgtgtgtgagtttataatggctttgtcattccgtcta |
16135125 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
16135126 |
tcta |
16135129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 549 - 652
Target Start/End: Complemental strand, 48209535 - 48209432
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||| ||||||||||||||||| |||||||| |||| |||||||||||||||||||||| |||||||||||| |||||||| ||||| ||||||||||| |
|
|
| T |
48209535 |
aaaataccgaaattgttaggccgaatgccatggccggagttcgaaccccggtaccttcacgtatgtgtgtgagcttataatgactttgtcatttcgtcta |
48209436 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
48209435 |
tcta |
48209432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 44107379 - 44107509
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||| |||| |||||||| ||||||||| || |||||||||||||||||||||||||||||||| |||||| |||||||| ||||| ||||||||| |
|
|
| T |
44107379 |
tatccacaagttctagctcaactggcaaaa--tgttgaaattgttaggccggatgccatgaccggggt-cgaacctcggtacctccacttgtgtgtgtga |
44107475 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| |||||| |||||||||||| |||| |
|
|
| T |
44107476 |
gtttataatagctttgtcatttcgtctatttacc |
44107509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 526 - 654
Target Start/End: Complemental strand, 44879358 - 44879232
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt-accttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
||||||||||| ||| ||||||||| || ||||||||||||||| |||| |||||||||||||| ||||||||| |||| ||||| ||||||||||||| |
|
|
| T |
44879358 |
agaagtcctagttcaactggcaaaa--tgtcgaaattgttaggccagatgtcatgaccggggttc-aaccccggtcacctccacttgtgtgtgtgagttt |
44879262 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||| |||||||||||||||||||||| |
|
|
| T |
44879261 |
ataatggttttgccatttcgtctatctacc |
44879232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 556 - 653
Target Start/End: Complemental strand, 5350015 - 5349918
Alignment:
| Q |
556 |
cgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||||||||||||| || |||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
5350015 |
cgaaattgttaggccggataccatgatcggggttcgaaccccggtacctccatttatgtttgtgagtttataatgactttgccatttcgtctttctac |
5349918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 549 - 654
Target Start/End: Complemental strand, 45475336 - 45475231
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||| ||||||||||||||||||||| |||| ||||||||||||||| ||||| ||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45475336 |
aaaataccgaaattgttaggccggatgttatgattggggttcgaaccccgatacctccacttgtgtgtgtgagtttataatggttttgccatttcgtcta |
45475237 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
45475236 |
tctacc |
45475231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 521 - 652
Target Start/End: Original strand, 23878944 - 23879073
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||| ||||||||||||| |||| ||||||||| ||||||||||||| |||| |||||| || |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
23878944 |
tatccacaagtcctagctcaactgg--aaaaatgcctaaattgttaggccagatgtcatgactggagttcgaaccccgatacctccacttatgtgtgtga |
23879041 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||| |||| | ||| ||||||||||||||| |
|
|
| T |
23879042 |
gtttacaatgacgttgtcatttcgtctatcta |
23879073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 570 - 654
Target Start/End: Complemental strand, 38486042 - 38485958
Alignment:
| Q |
570 |
cggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38486042 |
cggatgctatgaccggggttcgaactccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtctatctacc |
38485958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 523 - 654
Target Start/End: Original strand, 40639602 - 40639731
Alignment:
| Q |
523 |
tccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagt |
622 |
Q |
| |
|
||||||||| |||||||| |||| |||| | ||||||||||||||||||| ||| |||| |||||||||||||| | ||| ||||| ||||||||||| |
|
|
| T |
40639602 |
tccagaagttctagctcaactggtaaaata--ccgaaattgttaggccggacgccttgacgggggttcgaacccccgcccctccacttgtgtgtgtgagt |
40639699 |
T |
 |
| Q |
623 |
ttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |
|
|
| T |
40639700 |
ttataatggctttgtcatttcgtctatctacc |
40639731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 53583960 - 53584092
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcact--tatgtgtgtg |
619 |
Q |
| |
|
||||||||||||||||||| ||||||||| || ||||||||||||||||||| ||||||||||||| ||||||| | ||||| |||| | |||||||| |
|
|
| T |
53583960 |
atccagaagtcctagctcaactggcaaaa--tgtcgaaattgttaggccggattccatgaccggggtacgaacccagatacctccacttgtgtgtgtgtg |
53584057 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||| ||||||||||||| |||||||||||| |||| |
|
|
| T |
53584058 |
agtatataatggctttgtcatttcgtctatttacc |
53584092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 2900254 - 2900384
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||||||| |||||||| ||| |||| ||| ||| || ||||| | ||||| |||||||||| |
|
|
| T |
2900254 |
atccagaagtcctagctccactggcaaaa--tgccgaaattgttaagccggatgtcataaccgaagtttgaatcctggtacatccacttgtgtgtgtgag |
2900351 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
2900352 |
tttataatagctttgccatttcgtctatctacc |
2900384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 523 - 652
Target Start/End: Complemental strand, 10071645 - 10071517
Alignment:
| Q |
523 |
tccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagt |
622 |
Q |
| |
|
|||| ||||||||||||| ||| |||||| || | |||||||||||| |||||||||| ||||||||||||||| |||| ||||| || |||||||| |
|
|
| T |
10071645 |
tccacaagtcctagctcaactgacaaaaa-tgtcaaaattgttaggctggatgccatggtcggggttcgaaccccaacacctgcacttgtgcgtgtgagt |
10071547 |
T |
 |
| Q |
623 |
ttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10071546 |
ttataatggctttgccatttcgtctatcta |
10071517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 522 - 653
Target Start/End: Complemental strand, 40418604 - 40418477
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| | || |||||||| |||||||||||||| ||| ||||| |||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
40418604 |
atccagaagtcctagctcaacagg--aaaaatgctgaaattgttaggccaaatgtcatgatcggggttcgaaccccggtacctccact--tgtgtgtgag |
40418509 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
| ||||||||| ||| |||||||||||||||| |
|
|
| T |
40418508 |
tatataatggcgttgtcatttcgtctatctac |
40418477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 525 - 652
Target Start/End: Complemental strand, 46311569 - 46311446
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| |||| |||| || ||||||||||||||||||||| |||||||| ||||||||| ||||| ||||| ||||||||||||| |
|
|
| T |
46311569 |
cagaagtcctagctcaactggtaaaa--tgtcgaaattgttaggccggatgctatgaccgg--ttcgaaccctaatacctccacttgtgtgtgtgagttt |
46311474 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||| ||||||||||||||||||||| |
|
|
| T |
46311473 |
ataatgactttgccatttcgtctatcta |
46311446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 522 - 652
Target Start/End: Original strand, 11249959 - 11250085
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| ||||||||||||| |||| |||| ||| |||||||||||| |||||||||||| |||||||||||||| ||||||| ||| |||||||||| |
|
|
| T |
11249959 |
atccacaagtcctagctcaactggtaaaa--tgcagaaattgttaggtcggatgccatgatcggggttcgaaccctggtacctctact--tgtgtgtgag |
11250054 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||| ||||| ||||||||||||||| |
|
|
| T |
11250055 |
tttataatgactttgtcatttcgtctatcta |
11250085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 521 - 623
Target Start/End: Original strand, 2687557 - 2687657
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||||||||| ||||| |||||||||||||| | ||||| ||||| ||||||||| |
|
|
| T |
2687557 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatggcatgatcggggttcgaaccctgatacctccacttgtgtgtgtga |
2687654 |
T |
 |
| Q |
621 |
gtt |
623 |
Q |
| |
|
||| |
|
|
| T |
2687655 |
gtt |
2687657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 577 - 652
Target Start/End: Original strand, 11076457 - 11076532
Alignment:
| Q |
577 |
catgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11076457 |
catgaccggggttcgaaccccgatacctccacttgtgtgtgtgagtttataatggctttgccatttcgtctatcta |
11076532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 549 - 652
Target Start/End: Complemental strand, 16687652 - 16687551
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| || || ||||||||||||||||||||||||| |||||||| || |
|
|
| T |
16687652 |
aaaatgccgaaattgttaggccggac-ccatgaccggggttcgaacccaggtacctcca-ttgtgtgtgtgagtttataatggctttgtcatttcgttta |
16687555 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
16687554 |
tcta |
16687551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 549 - 635
Target Start/End: Complemental strand, 1218475 - 1218389
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggcttt |
635 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |||| ||||||| |||||||||||||||| |
|
|
| T |
1218475 |
aaaatgccgaaattgttaggccggatgccatgatcggggttcgaacctcggtacctctacttgtgtgtgttagtttataatggcttt |
1218389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 548 - 654
Target Start/End: Original strand, 29216829 - 29216935
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||| ||||||||||||||||||| | |||||||| |||| |||||||||||| |||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
29216829 |
aaaaatgtcgaaattgttaggccggatactatgaccggagttcaaaccccggtaccgccacttatgtgtgtgagtttataataactttgtcatttcgtca |
29216928 |
T |
 |
| Q |
648 |
atctacc |
654 |
Q |
| |
|
||||||| |
|
|
| T |
29216929 |
atctacc |
29216935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 520 - 653
Target Start/End: Original strand, 47570280 - 47570411
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
||||||| ||||||||||||| || || |||||| | ||||||||| |||||||| ||| | | |||||||||||||||||||| || ||||||||||| |
|
|
| T |
47570280 |
gtatccaaaagtcctagctcaact--cacaaaatgtcaaaattgttaagccggatgtcataatcagggttcgaaccccggtacctccatttatgtgtgtg |
47570377 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||| ||||| ||||| |||||||||| |
|
|
| T |
47570378 |
agtttataatgactttgtcattttgtctatctac |
47570411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 521 - 653
Target Start/End: Original strand, 38085804 - 38085934
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||| |||||||||| ||| ||||| || |||||||||||||||| ||| ||||| ||||| ||||||||||||| || ||||| |||| |||| |
|
|
| T |
38085804 |
tatccagaaatcctagctcaactgacaaaa--tgtcgaaattgttaggccgaatgacatgatcggggctcgaaccccggtaactccacttgtgtgcgtga |
38085901 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||| |||| |||||||||||||||||||||| |
|
|
| T |
38085902 |
atttaaaatgactttgccatttcgtctatctac |
38085934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 525 - 653
Target Start/End: Original strand, 43967926 - 43968051
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
||||| |||||||||| |||| ||| ||| ||||||||||||||||||| ||||| | |||||||||||||||||| | ||||| ||||||||||||| |
|
|
| T |
43967926 |
cagaaatcctagctcaactggtaaag--tgctgaaattgttaggccggatgtcatgatcagggttcgaaccccggtac-tccacttgtgtgtgtgagttt |
43968022 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||| |||||||||||||||| |
|
|
| T |
43968023 |
ataatggctttatcatttcgtctatctac |
43968051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 61; E-Value: 1e-25
Query Start/End: Original strand, 549 - 653
Target Start/End: Original strand, 1339244 - 1339348
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| |||||||||| | |||||| ||||| |||||||||||||||||| ||| ||||| |||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
1339244 |
aaaatgtcgaaattgtttgatcggatgtcatgatcggggttcgaaccccggtccctccacttgtgtgtgtgagtttataatggttttgtcatttcgtcta |
1339343 |
T |
 |
| Q |
649 |
tctac |
653 |
Q |
| |
|
||||| |
|
|
| T |
1339344 |
tctac |
1339348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 61; E-Value: 1e-25
Query Start/End: Original strand, 576 - 652
Target Start/End: Original strand, 30740911 - 30740987
Alignment:
| Q |
576 |
ccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30740911 |
ccatgaccagggttcgaaccccggtacctccacgtatgtgtgtgagtttataatggctttgcaatttcgtctatcta |
30740987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 61; E-Value: 1e-25
Query Start/End: Original strand, 531 - 654
Target Start/End: Original strand, 44791717 - 44791836
Alignment:
| Q |
531 |
tcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatg |
630 |
Q |
| |
|
|||||||||| ||||||||| ||| |||||||||| ||||| || |||| |||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
44791717 |
tcctagctcaactggcaaaa--tgctaaaattgttagaccggacgc-atgatcggggttcgaaccccgttacctccacttatgtgtgtgagtttataatg |
44791813 |
T |
 |
| Q |
631 |
gctttgccatttcgtctatctacc |
654 |
Q |
| |
|
| ||| |||||||||||||||||| |
|
|
| T |
44791814 |
g-tttaccatttcgtctatctacc |
44791836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 36518124 - 36518227
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||| ||||| |||||||||| ||| |||||||| | ||||| ||| ||||| ||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
36518124 |
aaaatgccgaaattattaggtcggatgccataaccagggttcgacctccggttcctccacttgtgtgtgtgagtttataatgactttgtcatttcgtcta |
36518223 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
36518224 |
tcta |
36518227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 588 - 654
Target Start/End: Original strand, 19163697 - 19163763
Alignment:
| Q |
588 |
ttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19163697 |
ttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtctatctacc |
19163763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 549 - 651
Target Start/End: Original strand, 36540129 - 36540231
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| ||||||||||||||| |||| |||||| | ||||||||||||| ||| ||||||| |||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
36540129 |
aaaatgtcgaaattgttaggccagatgtcatgactgaggttcgaaccccgatactttcacttgcgtgtgtgagtttataatgactttgtcatttcgtcta |
36540228 |
T |
 |
| Q |
649 |
tct |
651 |
Q |
| |
|
||| |
|
|
| T |
36540229 |
tct |
36540231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 40193086 - 40192955
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||| | |||| |||| || |||||||||||||||||||||||||| ||| |||||||||| ||||| || || ||||||||| |
|
|
| T |
40193086 |
tatccagaagtcctagcttaactggtaaaa--tgtcgaaattgttaggccggatgccatgatcggagttcgaacccttatacctccatttgtgtgtgtga |
40192989 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||| | ||| ||| |||||||||||| |
|
|
| T |
40192988 |
gtttataatggttgtgctattccgtctatctacc |
40192955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 32956794 - 32956899
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||| |||||||||||||| || | ||||||||||||||||||||| |||||| || |||||||||||| |||||||| |||||| ||||||||| |
|
|
| T |
32956794 |
aaaatgctgaaattgttaggccagacgtcatgaccggggttcgaaccccagtacctccatttatgtgtgtgaatttataatagctttgttatttcgtctt |
32956893 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
32956894 |
tctacc |
32956899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 32635403 - 32635507
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgcca-tttcgtct |
647 |
Q |
| |
|
|||||| ||||||| ||||| |||||| ||||| |||||||||||||||||||||| ||||| |||||| |||||||||||| ||||| || |||||||| |
|
|
| T |
32635403 |
aaaatgtcgaaattattaggtcggatgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgcgagtttataatgactttgtcattttcgtct |
32635502 |
T |
 |
| Q |
648 |
atcta |
652 |
Q |
| |
|
||||| |
|
|
| T |
32635503 |
atcta |
32635507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 560 - 652
Target Start/End: Original strand, 51402858 - 51402950
Alignment:
| Q |
560 |
attgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||| || || ||| |||||||| ||||||||| ||||| |||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
51402858 |
attgttaggccggatgtcaagaacggagttcgaactccggtacctccacttgtgtgtgtgagtttataatggttttgtcatttcgtctatcta |
51402950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 549 - 652
Target Start/End: Complemental strand, 6419769 - 6419666
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||| | ||||||||| ||||||| ||||| | |||||||||||||||| ||||| ||||||||||| |
|
|
| T |
6419769 |
aaaatgtcgaaattgttaggccggatgtcatgaccagcgttcgaaccgcggtacccccacttgtatgtgtgagtttataataactttgtcatttcgtcta |
6419670 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
6419669 |
tcta |
6419666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 18271601 - 18271703
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||| || ||| | |||||||| ||||| ||| ||||||||||||||| ||||||||||| ||||| |
|
|
| T |
18271601 |
aaaatgccgaaattgttaggtcggatgccatgatcgggttt-gaatctcggtacctccacttgtgtatgtgagtttataatgactttgccatttagtcta |
18271699 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
18271700 |
tcta |
18271703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 549 - 652
Target Start/End: Complemental strand, 27719220 - 27719117
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| ||||||||||| | ||||| ||||||||| ||||||||| || ||||| || |||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
27719220 |
aaaatgtcgaaattgttaagtcggatatcatgaccggagttcgaacctcgatacctccatttatgtgtgtgaatttataatggctttgccattccgtcta |
27719121 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
27719120 |
tcta |
27719117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 520 - 654
Target Start/End: Complemental strand, 32946483 - 32946352
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
|||||||||||||||| |||| ||| ||||| ||| |||||||||| | ||||| |||||| | || |||||||| |||||||| ||||| ||||| | |
|
|
| T |
32946483 |
gtatccagaagtcctaactcaactgtcaaaa--tgctgaaattgttaagtcggattccatgatcagg-ttcgaaccacggtacctccacttgcgtgtgag |
32946387 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
32946386 |
agtttataatggctttaccatttcgtctatctacc |
32946352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 547 - 653
Target Start/End: Complemental strand, 46316583 - 46316477
Alignment:
| Q |
547 |
aaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||| ||||| |||||| | ||||| |||| |||||||||||||||||| ||||| ||||||||| |
|
|
| T |
46316583 |
aaaaaatgccgaaattgttaggtcggatgtcatgactagggtttgaaccctgatacctctacttgtgtgtgtgagtttataataactttgtcatttcgtc |
46316484 |
T |
 |
| Q |
647 |
tatctac |
653 |
Q |
| |
|
||||||| |
|
|
| T |
46316483 |
tatctac |
46316477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 550 - 654
Target Start/End: Complemental strand, 16738090 - 16737985
Alignment:
| Q |
550 |
aaatgccgaaattgttaggccgga-tgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||||||||||||||| |||| || | ||| ||||||||||| ||| |||| ||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16738090 |
aaatgccgaaattgttaggacggaatgtcttgatcggggttcgaatcccatcacctccacttatatgtgtgattttataatggctttgccatttcgtcta |
16737991 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
16737990 |
tctacc |
16737985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 549 - 642
Target Start/End: Complemental strand, 46800136 - 46800044
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccattt |
642 |
Q |
| |
|
||||||||||||||||||| |||||| |||||| |||||| |||||| ||||||| ||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
46800136 |
aaaatgccgaaattgttagatcggatgtcatgactggggtttgaaccc-ggtacctccacttgtgtgtgtgaatttataatggctttgccattt |
46800044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 548 - 649
Target Start/End: Original strand, 55068950 - 55069051
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||||| || ||||||||| | ||||||||| |||| ||||||||||| ||||| ||||||| ||||| ||||||||| | |||||||||||||||| |
|
|
| T |
55068950 |
aaaaatgccaaagttgttaggctgaatgccatgatcgggattcgaaccccgatacctccacttatatgtgtaagtttataaagactttgccatttcgtct |
55069049 |
T |
 |
| Q |
648 |
at |
649 |
Q |
| |
|
|| |
|
|
| T |
55069050 |
at |
55069051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 522 - 652
Target Start/End: Complemental strand, 21402787 - 21402661
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||| | |||| |||| |||||||||||||||| ||| | |||||||||| ||||| |
|
|
| T |
21402787 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaaatcagatgttatgatcggggttcgaaccccgatacttccacttatgtgggtgag |
21402690 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||| ||||| ||||||||||||||| |
|
|
| T |
21402689 |
--tataatgactttgtcatttcgtctatcta |
21402661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 576 - 652
Target Start/End: Complemental strand, 32597424 - 32597346
Alignment:
| Q |
576 |
ccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg--agtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||| |||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
32597424 |
ccatgaccggggttcgaatcccggtacctccacttgtgtgtgtgtgagtttataatggctttaccatttcgtctatcta |
32597346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 46828918 - 46829021
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||| |||| ||||||| | |||| ||||| ||| || |||||||||||| ||||| ||||||||||| |
|
|
| T |
46828918 |
aaaatgtcgaaattattaggccggatgccatgaccatggtttgaaccccagaacctccacttgtgtatgcgagtttataatgtctttgtcatttcgtcta |
46829017 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
46829018 |
tcta |
46829021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 522 - 619
Target Start/End: Original strand, 47408839 - 47408935
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttc-gaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
||||||||||||||||||| || |||||| |||||||||||||||||||||| |||||| ||||||| |||| ||||||||| |||||||||||||| |
|
|
| T |
47408839 |
atccagaagtcctagctcaactagcaaaa--tgccgaaattgttaggccggataccatgaatggggttcggaactccggtacctccacttatgtgtgtg |
47408935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 557 - 654
Target Start/End: Original strand, 2666246 - 2666341
Alignment:
| Q |
557 |
gaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||| || ||||| ||||||| || |||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2666246 |
gaaattgttaggccgtatatcatgaatggggttcaaatcccgatacctccactt--gtgtgtgagtttataatggctttgccatttcgtctatctacc |
2666341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 548 - 654
Target Start/End: Original strand, 31828423 - 31828528
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||||||||||||||||||| |||| || |||||||||||||| |||| |||| ||||| |||||||| |||||| |||| |||||||| || ||| |
|
|
| T |
31828423 |
aaaaatgccgaaattgttaggccagatgtaataaccggggttcgaactccggcacctccactt-tgtgtgtgtgtttatgatggttttgccatctcttct |
31828521 |
T |
 |
| Q |
648 |
atctacc |
654 |
Q |
| |
|
||||||| |
|
|
| T |
31828522 |
atctacc |
31828528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 525 - 646
Target Start/End: Complemental strand, 32630741 - 32630622
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||| ||||||| |||| |||| ||| ||||||||| || ||||| ||||| || ||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
32630741 |
cagaagtcatagctcaactggtaaaa--tgctaaaattgttaagctggatgtcatgattggagttcgaacctcggtacctccacttatgtgtgtgagtta |
32630644 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtc |
646 |
Q |
| |
|
||||||||| |||||||||||| |
|
|
| T |
32630643 |
ataatggctatgccatttcgtc |
32630622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 49443127 - 49443230
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| |||||||||||||| |||| ||||| || |||||||||||||||||| |||||| ||||||||||||||||||| || ||||||||||| |
|
|
| T |
49443127 |
aaaatgtcgaaattgttaggcatgatgtaatgactggagttcgaaccccggtacctccactta--tgtgtgagtttataatggcattaccatttcgtctg |
49443224 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
49443225 |
tctacc |
49443230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 548 - 654
Target Start/End: Original strand, 34844012 - 34844122
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcact----tatgtgtgtgagtttataatggctttgccatttc |
643 |
Q |
| |
|
||||||| |||||||||| |||||| |||||||||| |||||||||||||| |||| | || | ||||||||||||||||||||| |||||||||| |
|
|
| T |
34844012 |
aaaaatgttgaaattgttatgccggacgccatgaccgaggttcgaaccccggcacctccccttgtgtgtgtgtgtgagtttataatggcattgccatttc |
34844111 |
T |
 |
| Q |
644 |
gtctatctacc |
654 |
Q |
| |
|
||| ||||||| |
|
|
| T |
34844112 |
gtccatctacc |
34844122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 51053642 - 51053747
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||||||| || | | ||||| |||||||||||||||| | |||||||| |||| || |||||||||| ||||| ||||||||||| |
|
|
| T |
51053642 |
aaaatgccgaaattgttaggtcgaacgtcatgatcggggttcgaaccccgacaacttcacttgtgtgcgtaggtttataatgactttgtcatttcgtcta |
51053741 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
51053742 |
tctacc |
51053747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 549 - 653
Target Start/End: Complemental strand, 21569310 - 21569206
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| | ||||||||||| |||||| ||||||||| ||||||||||| |||||| || | |||||||| ||||||||| | ||||| |||||||||| |
|
|
| T |
21569310 |
aaaatgacaaaattgttaggacggatgtcatgaccggtattcgaaccccgatacctttacatgtgtgtgtgggtttataatagttttgctatttcgtcta |
21569211 |
T |
 |
| Q |
649 |
tctac |
653 |
Q |
| |
|
||||| |
|
|
| T |
21569210 |
tctac |
21569206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 49285532 - 49285635
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| ||||||||||||| || ||| ||||||||||| ||| | | |||||| |||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
49285532 |
aaaatgtcgaaattgttaggtcgaatgttttgaccggggtttgaaactcagtacctctacttatgtgtgtgagtttataatgactttgtcatttcgtcta |
49285631 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
49285632 |
tcta |
49285635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 549 - 643
Target Start/End: Complemental strand, 35755779 - 35755686
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttc |
643 |
Q |
| |
|
||||||||||||||||||| || |||||||||| |||||| ||||| | |||||| |||||||||||||||| ||||||| | ||||||||||| |
|
|
| T |
35755779 |
aaaatgccgaaattgttagaccagatgccatgatcggggt-cgaacatcagtacctccacttatgtgtgtgagcttataatagttttgccatttc |
35755686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 521 - 653
Target Start/End: Original strand, 39172038 - 39172166
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||| |||||||||||| | ||||||||| || | |||||||||||||| ||| ||||| ||||||| |||||| |||||| || || |||||||| |
|
|
| T |
39172038 |
tatcaagaagtcctagcataactggcaaaa--tgtcaaaattgttaggccgaatgtcatgattggggttcaaaccccagtacctccattt--gtgtgtga |
39172133 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |
|
|
| T |
39172134 |
atttataatggctttgccatttcgtctacctac |
39172166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 525 - 654
Target Start/End: Original strand, 41921508 - 41921626
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| |||| |||| |||||||||||||||||| |||| ||||| ||||||||| ||| ||||| | ||||||||||| |
|
|
| T |
41921508 |
cagaagtcctagctcaactggtaaaa--tgccgaaattgttaggccagatgtcatgattggggttcga---------cctccacttgtttgtgtgagttt |
41921596 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||| |||||||||| |
|
|
| T |
41921597 |
ataatggctttgccatttcatctatctacc |
41921626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 584 - 653
Target Start/End: Original strand, 13777531 - 13777600
Alignment:
| Q |
584 |
ggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||| |||||| ||||| |||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13777531 |
ggggttcaaaccccaatacctccactcgtgtgtgtgagtttataatggctttgccatttcgtctatctac |
13777600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 549 - 649
Target Start/End: Complemental strand, 23526010 - 23525912
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| | ||||||||||| ||||||| |||| ||||||| ||| ||||||||| |||||||| ||||||||||||||| ||||| ||||||||||| |
|
|
| T |
23526010 |
aaaatgtcaaaattgttaggtcggatgctatgatcggggttataactccggtacctccacttatg--tgtgagtttataatgactttgtcatttcgtcta |
23525913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 556 - 653
Target Start/End: Complemental strand, 42683151 - 42683054
Alignment:
| Q |
556 |
cgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||| ||||||| | |||| | |||||||||||||| ||| | |||||||||||||||||||||||||| ||| |||||||| ||||||| |
|
|
| T |
42683151 |
cgaaattgttgagccggattctatgatcagggttcgaaccccgatacttccacttatgtgtgtgagtttataatggttttatcatttcgtatatctac |
42683054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 554 - 614
Target Start/End: Complemental strand, 2947819 - 2947759
Alignment:
| Q |
554 |
gccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgt |
614 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| | |||||| ||||||||| |
|
|
| T |
2947819 |
gccgaaattgttaggccggatgtcatgaccggggttcgaaccacagtacctccacttatgt |
2947759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 577 - 652
Target Start/End: Complemental strand, 39922723 - 39922650
Alignment:
| Q |
577 |
catgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||| || ||||||||||||||| |||| ||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
39922723 |
catgaccgggatttgaaccccggtacctttactt--gtgtgtgagtttataatggctctgccattttgtctatcta |
39922650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 558 - 654
Target Start/End: Original strand, 54950068 - 54950163
Alignment:
| Q |
558 |
aaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||| |||||||||| ||||| |||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
54950068 |
aaattgttaggtcgggtgccatgacaaaggttcgaacct-ggtaccttcagatatgtatgtgagtttataatagctttgtcatttcgtctatctacc |
54950163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 548 - 654
Target Start/End: Original strand, 4659561 - 4659668
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcactt-atgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
|||||||| |||||| ||||||||||| | ||| ||| |||||||||| | ||||| ||||| |||||||||||||||||||| |||| ||| ||||| |
|
|
| T |
4659561 |
aaaaatgctgaaattaataggccggatgtcttgatcggtgttcgaaccctgatacctccactttatgtgtgtgagtttataatgactttttcatctcgtc |
4659660 |
T |
 |
| Q |
647 |
tatctacc |
654 |
Q |
| |
|
|||||||| |
|
|
| T |
4659661 |
tatctacc |
4659668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 592 - 654
Target Start/End: Complemental strand, 26764526 - 26764463
Alignment:
| Q |
592 |
aaccccggtaccttcacttatgtgtgtgagttt-ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| ||| ||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26764526 |
aaccccggtgcctccacttgtgtgtgtgagttttataatggctttgccatttcgtctatctacc |
26764463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 558 - 654
Target Start/End: Original strand, 35966271 - 35966371
Alignment:
| Q |
558 |
aaattgttaggccggatgccatgaccggggttcgaaccccggtaccttca----cttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||| ||||||||||| |||||||| ||||||||||||||||||| || || ||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
35966271 |
aaatagttaggccggacctcatgaccgaggttcgaaccccggtacctccaattgtttgtgtgtgtgagtttataatgactttgtcatttcgtctatctac |
35966370 |
T |
 |
| Q |
654 |
c |
654 |
Q |
| |
|
| |
|
|
| T |
35966371 |
c |
35966371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 526 - 653
Target Start/End: Complemental strand, 42483052 - 42482925
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag-ttt |
624 |
Q |
| |
|
||||||||||||||| ||| | ||||||||||||||||||| ||||||| ||||| | | | ||||||||||||||| ||||| ||| |||| ||| |
|
|
| T |
42483052 |
agaagtcctagctcaactg--agaaaatgccgaaattgttagaccggatgtcatgattgtgttacgaaccccggtacctccactttgatgtatgagtttt |
42482955 |
T |
 |
| Q |
625 |
ataatggctttgccatttc-gtctatctac |
653 |
Q |
| |
|
|||||||||||| |||||| |||||||||| |
|
|
| T |
42482954 |
ataatggctttgtcatttcggtctatctac |
42482925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 18462086 - 18461959
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||||| || ||||| |||| |||| || ||||||| |||| ||||||| || || ||||||||||||||| ||||| ||||||||||| |
|
|
| T |
18462086 |
tatccagaagttctggctcaactggtaaaa--tgtcgaaattattagaccggatgtcaagatcggggttcgaacccccatacctccacttatgtgt---- |
18461993 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||| |||| ||||||| |||||||||| |
|
|
| T |
18461992 |
gtttataatgactttaccatttcatctatctacc |
18461959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 549 - 653
Target Start/End: Complemental strand, 4039811 - 4039708
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| ||||||| ||||| |||| |||||||| ||||||||||||||| ||| |||| | | ||||||||||||||||| ||| ||||||||||| |
|
|
| T |
4039811 |
aaaatgtcgaaattattaggtcggacgccatgactagggttcgaaccccggcgcctctacttgt-tatgtgagtttataatggccttgtcatttcgtcta |
4039713 |
T |
 |
| Q |
649 |
tctac |
653 |
Q |
| |
|
||||| |
|
|
| T |
4039712 |
tctac |
4039708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 579 - 648
Target Start/End: Complemental strand, 21507531 - 21507466
Alignment:
| Q |
579 |
tgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||||||||||| ||||| |||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21507531 |
tgaccggggttcgaaacccggcacctccactt----gtgtgagtttataatggctttgccatttcgtcta |
21507466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 596 - 648
Target Start/End: Complemental strand, 39928845 - 39928793
Alignment:
| Q |
596 |
ccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||| | ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39928845 |
ccggtacatccacttatgtgtgtgaatttataatggctttgccatttcgtcta |
39928793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 607 - 654
Target Start/End: Complemental strand, 11056118 - 11056071
Alignment:
| Q |
607 |
acttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
11056118 |
acttgtgtgtgtgagtttataatggctttgtcatttcgtctatctacc |
11056071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 556 - 652
Target Start/End: Complemental strand, 20625745 - 20625653
Alignment:
| Q |
556 |
cgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||| |||||||||||| | ||||||||| | |||||||| ||| |||||||||||| |||| ||||| ||||||||||||||| |
|
|
| T |
20625745 |
cgaaattgttaggtcggatgccatgatcagggttcgaatctcggtacct----ctatatgtgtgagtttacaatgactttgtcatttcgtctatcta |
20625653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 522 - 630
Target Start/End: Original strand, 19961368 - 19961475
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttca-cttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||| |||| ||| ||||| || ||||||||||||| |||||| |||||| |||||||| ||||||||| || || ||| |||| | || |
|
|
| T |
19961368 |
atccagaagtcctaactcaactgacaaaa--tgtcgaaattgttaggtcggatgtcatgactggggttcgtaccccggtatctccaccttgtgtgcgaga |
19961465 |
T |
 |
| Q |
621 |
gtttataatg |
630 |
Q |
| |
|
|||||||||| |
|
|
| T |
19961466 |
gtttataatg |
19961475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 577 - 654
Target Start/End: Original strand, 21129098 - 21129176
Alignment:
| Q |
577 |
catgaccggggttcgaaccccggtaccttcactta-tgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||| |||||||||||||||||||||| |||| ||| ||||||||||| ||||||||||||| | ||||||||||| |
|
|
| T |
21129098 |
catgatcggggttcgaaccccggtacctctactttgtgtttgtgagtttatgatggctttgccatcttgtctatctacc |
21129176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 556 - 653
Target Start/End: Original strand, 12405594 - 12405691
Alignment:
| Q |
556 |
cgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||||| |||||| || | | ||||||||| |||||| |||||||| | || |||||||||||||| |||| |||||||||||||||| |
|
|
| T |
12405594 |
cgaaattgttaggtcggatgtcaatatcagggttcgaatcccggttacttcacttgtatgcatgagtttataatggttttgtcatttcgtctatctac |
12405691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 549 - 654
Target Start/End: Complemental strand, 25313030 - 25312925
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||| ||||||||||| |||||| ||| |||||| |||||||| || ||| | || || ||| |||||||||||||| ||| | ||||| ||||| |
|
|
| T |
25313030 |
aaaatgccaaaattgttaggtcggatgtcataaccgggattcgaacctcgatacttccatttgtgtatgtgagtttataattgctaagtcattttgtcta |
25312931 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
25312930 |
tctacc |
25312925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 549 - 594
Target Start/End: Complemental strand, 35208169 - 35208124
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaac |
594 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35208169 |
aaaatgctgaaattgttaggccggatgtcatgaccggggttcgaac |
35208124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 549 - 645
Target Start/End: Original strand, 43357244 - 43357338
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgt |
645 |
Q |
| |
|
||||| |||||||||||| ||||||||| |||| || |||| ||||||| |||||||||| |||||||| ||||||||||| || | |||||||| |
|
|
| T |
43357244 |
aaaattccgaaattgttaagccggatgctatgatcgaggtttgaaccccaataccttcact--tgtgtgtgggtttataatggtttcgacatttcgt |
43357338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 9318542 - 9318644
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||| |||| ||||||| | | |||||||| | ||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
9318542 |
aaaatgtcgaaattgttaggctggatgtcataaccgatgttcgaatct-gataccttcagatgtgtgtgtgagtttataatgattttgtcatttcgtcta |
9318640 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
9318641 |
tcta |
9318644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 557 - 654
Target Start/End: Complemental strand, 27845211 - 27845113
Alignment:
| Q |
557 |
gaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||| | ||||| |||||||||| || ||||| || ||||||||||||||||||||||| ||| ||| ||||||||||||| |
|
|
| T |
27845211 |
gaaattgttaggccggacgtcatgattggggttcgaattccaatacctcaactttatgtgtgtgagtttataatggttttatcatctcgtctatctacc |
27845113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 580 - 652
Target Start/End: Complemental strand, 7131576 - 7131503
Alignment:
| Q |
580 |
gaccggggttcgaaccccggtaccttcactta-tgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||| || ||||| ||||| ||||||||||||||| ||||||||||||| || |||||||| |
|
|
| T |
7131576 |
gaccggggttcgaacttcgatacctccactttgtgtgtgtgagtttatgatggctttgccatctcttctatcta |
7131503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 548 - 652
Target Start/End: Original strand, 10514571 - 10514675
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||| || ||| ||||| ||| || |||||||||||||| || ||||| || |||||| |
|
|
| T |
10514571 |
aaaaatgccgaaattgttaggccggatgtcatggtcggggttc-aaatccgatacctacactttgcgtgtgtgagtttatgataactttgtcaattcgtc |
10514669 |
T |
 |
| Q |
647 |
tatcta |
652 |
Q |
| |
|
|||||| |
|
|
| T |
10514670 |
tatcta |
10514675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 558 - 650
Target Start/End: Complemental strand, 38417820 - 38417727
Alignment:
| Q |
558 |
aaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcactt-atgtgtgtgagtttataatggctttgccatttcgtctatc |
650 |
Q |
| |
|
||||||||||| |||| | ||||||| | |||||||||||| |||| |||| |||||||||||||||||||| |||| ||| ||||||||| |
|
|
| T |
38417820 |
aaattgttaggtcggacgtcatgaccagagttcgaaccccgatacccctactttatgtgtgtgagtttataatgattttgtcatctcgtctatc |
38417727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 526 - 596
Target Start/End: Original strand, 4601429 - 4601496
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
596 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| |||||||| | ||||||| |||||||||||| |
|
|
| T |
4601429 |
agaagtcctagctcaactggcaaa---tgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
4601496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 526 - 596
Target Start/End: Complemental strand, 7824578 - 7824511
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
596 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| |||||||| | ||||||| |||||||||||| |
|
|
| T |
7824578 |
agaagtcctagctcaactggcaaa---tgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
7824511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 526 - 596
Target Start/End: Complemental strand, 29689606 - 29689539
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
596 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| |||||||| | ||||||| |||||||||||| |
|
|
| T |
29689606 |
agaagtcctagctcaactggcaaa---tgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
29689539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 585 - 652
Target Start/End: Original strand, 32765600 - 32765665
Alignment:
| Q |
585 |
gggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||| |||||||||||| |||| |||||||||||||| |
|
|
| T |
32765600 |
gggttcgaaccccgacaccttcactta--tgtgtaagtttataatggttttgttatttcgtctatcta |
32765665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 528 - 604
Target Start/End: Complemental strand, 33746100 - 33746026
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacct |
604 |
Q |
| |
|
|||||||| |||||||| || ||| |||||||||||||||| |||||| ||||| | |||||| ||||||||||||| |
|
|
| T |
33746100 |
aagtcctaactcagctgacacaaa-tgccgaaattgttaggtcggatgtcatga-ctgggttcaaaccccggtacct |
33746026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 526 - 596
Target Start/End: Complemental strand, 51666049 - 51665982
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
596 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| |||||||| | ||||||| |||||||||||| |
|
|
| T |
51666049 |
agaagtcctagctcaactggcaaa---tgccgaaattgcaaggccggacgtcatgacctgggttcgaaccc |
51665982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 526 - 596
Target Start/End: Complemental strand, 54151805 - 54151738
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
596 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| |||||||| | ||||||| |||||||||||| |
|
|
| T |
54151805 |
agaagtcctagctcaactggcaaa---tgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
54151738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 548 - 651
Target Start/End: Original strand, 54923509 - 54923613
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttca-cttatgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
||||||| ||||||||||||| |||| | |||||||||||||||||| ||| ||| | || || ||||||||| ||||| ||| |||| ||| ||||| |
|
|
| T |
54923509 |
aaaaatgtcgaaattgttaggtcggacgtcatgaccggggttcgaactccgatacttccattttgtgtgtgtgaatttatgatgattttgtcatctcgtc |
54923608 |
T |
 |
| Q |
647 |
tatct |
651 |
Q |
| |
|
||||| |
|
|
| T |
54923609 |
tatct |
54923613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 548 - 630
Target Start/End: Complemental strand, 47665315 - 47665232
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcactt-atgtgtgtgagtttataatg |
630 |
Q |
| |
|
||||||| |||||||||||||||||| | ||| ||||||| |||| || ||||| ||||| |||||||||||||||||||| |
|
|
| T |
47665315 |
aaaaatgtcgaaattgttaggccggacatcttgatcggggtttgaactccaatacctccactttatgtgtgtgagtttataatg |
47665232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 580 - 629
Target Start/End: Original strand, 42446459 - 42446506
Alignment:
| Q |
580 |
gaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataat |
629 |
Q |
| |
|
|||||| |||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
42446459 |
gaccggagttcgaaccccggtacctccact--tgtgtgtgagtttataat |
42446506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 522 - 579
Target Start/End: Original strand, 38485539 - 38485596
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccat |
579 |
Q |
| |
|
||||||||||||||||||| ||| |||||||| | |||||||||||| |||||||| |
|
|
| T |
38485539 |
atccagaagtcctagctcaactgtaaaaaaatgtcaaaattgttaggctagatgccat |
38485596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 543 - 653
Target Start/End: Complemental strand, 49407737 - 49407625
Alignment:
| Q |
543 |
tggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga--gtttataatggctttgccat |
640 |
Q |
| |
|
||||||||| || | ||||||||||| |||||| |||| | |||| ||||||| |||| ||||||||||||||| |||||||||| |||| ||| |
|
|
| T |
49407737 |
tggcaaaaattgtcaaaattgttaggtcggatgtcatgttcaaggtttaaaccccgacacctccacttatgtgtgtgaaagtttataatgattttgtcat |
49407638 |
T |
 |
| Q |
641 |
ttcgtctatctac |
653 |
Q |
| |
|
|| |||||||||| |
|
|
| T |
49407637 |
tttgtctatctac |
49407625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 109; Significance: 2e-54; HSPs: 171)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 2e-54
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 25063338 - 25063469
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||| ||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
25063338 |
atccagaagtcctagttcaactggcaaaa-atgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
25063436 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
25063437 |
tttataatggctttgccatttcgtctatctacc |
25063469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 106; E-Value: 1e-52
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 4430864 - 4430734
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
4430864 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
4430767 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4430766 |
tttataatggctttgccatttcgtctatctacc |
4430734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 106; E-Value: 1e-52
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 6317299 - 6317429
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
6317299 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
6317396 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6317397 |
tttataatggctttgccatttcgtctatctacc |
6317429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 106; E-Value: 1e-52
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 19649627 - 19649497
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||| ||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
19649627 |
atccagaagtcatagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgag |
19649530 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
19649529 |
tttataatggctttgtcatttcgtctatctacc |
19649497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 106; E-Value: 1e-52
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 24654973 - 24655103
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24654973 |
atccagaagtcctagctcaactggcaaaa--tgccaaaattgttaggccggatgccatgactggggttcgaaccccggtaccttcacttgtgtgtgtgag |
24655070 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
24655071 |
tttataatggctttgccatttcgtctatctacc |
24655103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 106; E-Value: 1e-52
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 34711684 - 34711554
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
34711684 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggtcggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
34711587 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34711586 |
tttataatggctttgccatttcgtctatctacc |
34711554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 104; E-Value: 2e-51
Query Start/End: Original strand, 522 - 652
Target Start/End: Original strand, 27928157 - 27928285
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
27928157 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttagaccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
27928254 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
27928255 |
tttataatggctttgccatttcgtctatcta |
27928285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 103; E-Value: 8e-51
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 4977164 - 4977033
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
4977164 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggaccccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
4977067 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
4977066 |
gtttataatggctttgccatttcgtctatctacc |
4977033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 103; E-Value: 8e-51
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 25250783 - 25250913
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25250783 |
tatccagaagtcctagctcaactggcaaaa--tgccaaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtga |
25250880 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
25250881 |
gtttataatggctttgccattt-gtctatctacc |
25250913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 103; E-Value: 8e-51
Query Start/End: Original strand, 525 - 654
Target Start/End: Original strand, 26690696 - 26690823
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| ||||||||||||| |
|
|
| T |
26690696 |
cagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
26690793 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26690794 |
ataatggctttgccatttcgtctatctacc |
26690823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 103; E-Value: 8e-51
Query Start/End: Original strand, 525 - 654
Target Start/End: Original strand, 37295128 - 37295255
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
37295128 |
cagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
37295225 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |
|
|
| T |
37295226 |
ataatggctttgtcatttcgtctatctacc |
37295255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 103; E-Value: 8e-51
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 38953610 - 38953479
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||| ||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
38953610 |
tatccagaagtcttagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
38953513 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
38953512 |
gtttataatggctttgccatttcgtctatctacc |
38953479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 102; E-Value: 3e-50
Query Start/End: Original strand, 526 - 654
Target Start/End: Original strand, 10096615 - 10096741
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||||||||| ||||||||| || ||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
10096615 |
agaagtcctagctcaactggcaaaa--tgtcgaaattgttaggccggatgccatgaccggggttcgaaccccgatacctccacttatgtgtgtgagttta |
10096712 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10096713 |
taatggctttgccatttcgtctatctacc |
10096741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 101; E-Value: 1e-49
Query Start/End: Original strand, 507 - 654
Target Start/End: Original strand, 2733600 - 2733744
Alignment:
| Q |
507 |
aaagggacttatagtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttc |
606 |
Q |
| |
|
|||||| | ||||| ||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
2733600 |
aaagggccatataggatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacc-cc |
2733696 |
T |
 |
| Q |
607 |
acttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2733697 |
acttgtgtgtgtgagtttataatagctttgccatttcgtctatctacc |
2733744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 99; E-Value: 2e-48
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 14188088 - 14188219
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| || |||||||||||||||||||||||||||| |||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
14188088 |
tatccagaagtcctagctcaactggcaaaa--tgtcgaaattgttaggccggatgccatgacctgggttcgaaccccggtacctccacttgtgtgtgtga |
14188185 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
14188186 |
gtttataatgactttgccatttcgtctatctacc |
14188219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 99; E-Value: 2e-48
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 36586480 - 36586611
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| | ||||||| |
|
|
| T |
36586480 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggtcggatgccatgaccggggttcgaaccccggtacctccacttgtatgtgtga |
36586577 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
36586578 |
gtttataatggctttgtcatttcgtctatctacc |
36586611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 98; E-Value: 8e-48
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 4312132 - 4312262
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||| ||||||||||||| ||||||||||| ||||||||| ||||| |||||||||| |
|
|
| T |
4312132 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggtcggatgccatgactggggttcgaactccggtacctccacttgtgtgtgtgag |
4312229 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4312230 |
tttataatggctttgccatttcgtctatctacc |
4312262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 98; E-Value: 8e-48
Query Start/End: Original strand, 521 - 653
Target Start/End: Original strand, 25199044 - 25199174
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| |||| |||| |||||||||||||||||||||||| ||||||||| ||||||||||||||||| ||||| ||||||||| |
|
|
| T |
25199044 |
tatccagaagtcctagctcaactggtaaaa--tgccgaaattgttaggccggatgctatgaccgggtttcgaaccccggtacctccacttgtgtgtgtga |
25199141 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
25199142 |
gtttataatggctttgccatttcgtctatctac |
25199174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 98; E-Value: 8e-48
Query Start/End: Original strand, 526 - 654
Target Start/End: Original strand, 44814866 - 44814992
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
44814866 |
agaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttta |
44814963 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||| |||||||||| |
|
|
| T |
44814964 |
taatggctttgccatttcatctatctacc |
44814992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 97; E-Value: 3e-47
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 27849872 - 27849742
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
|||||||||||||| |||| ||| |||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
27849872 |
atccagaagtcctaactcaactgacaaaaa-tgccgaaattgttaggccggatgc-atgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
27849775 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
27849774 |
tttataatggctttgccatttcgtctatctacc |
27849742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 97; E-Value: 3e-47
Query Start/End: Original strand, 521 - 652
Target Start/End: Complemental strand, 38070611 - 38070482
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||| |||||||| |||||||| ||||| ||||||||| |
|
|
| T |
38070611 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgacatgaccgggattcgaaccacggtacctccacttgtgtgtgtga |
38070514 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38070513 |
gtttataatggctttgccatttcgtctatcta |
38070482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 525 - 654
Target Start/End: Original strand, 23681012 - 23681139
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
||||||||||| |||| ||||||||| |||| ||||| ||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
23681012 |
cagaagtcctaactcaactggcaaaa--tgccaaaattattaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
23681109 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
23681110 |
ataatggctttgccatttcgtctatctacc |
23681139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 31639232 - 31639101
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||||||||| |||| || |||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
31639232 |
tatccagaagtcctaactcaactagcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaactccggtacctccacttatgtgtgtgg |
31639135 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
31639134 |
gtttataatgactttgccatttcgtctatctacc |
31639101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 26737970 - 26738100
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| |||| |||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
26737970 |
atccagaagtcctagctcaactggtaaaa--tgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgaa |
26738067 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
26738068 |
tttataatggctttaccatttcgtctatctacc |
26738100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 93; E-Value: 8e-45
Query Start/End: Original strand, 519 - 654
Target Start/End: Complemental strand, 37708579 - 37708446
Alignment:
| Q |
519 |
agtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgt |
618 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||| |||||||||||||||| ||||||| ||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
37708579 |
agtatccataagtcctagctcaactggcaaaa--tgccgaaattgttaggacggatgctatgaccggggttcgaaccccggtacctccacttgtgtgtgt |
37708482 |
T |
 |
| Q |
619 |
gagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37708481 |
aagtttataatggctttgtcatttcgtctatctacc |
37708446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 92; E-Value: 3e-44
Query Start/End: Original strand, 555 - 654
Target Start/End: Complemental strand, 40772663 - 40772564
Alignment:
| Q |
555 |
ccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40772663 |
ccgaaattgttaggccggatgccatgatcggggttcgaaccccggtaccttcacttgtgtgtgtgagtttataatggctttgccatttcgtctatctacc |
40772564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 91; E-Value: 1e-43
Query Start/End: Original strand, 525 - 654
Target Start/End: Complemental strand, 34540190 - 34540063
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||| ||| ||||||||| ||||||||||||||||||||||||||||| ||||||| ||| |||||||||| ||||| ||||||||||||| |
|
|
| T |
34540190 |
cagaagtcctagttcaactggcaaaa--tgccgaaattgttaggccggatgccatgatcggggtttgaatcccggtacctccacttgtgtgtgtgagttt |
34540093 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34540092 |
ataatggctttgccatttcgtctatctacc |
34540063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 526 - 654
Target Start/End: Original strand, 16501651 - 16501776
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||||||||| |||||||||| ||| || |||||||||| |||||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
16501651 |
agaagtcctagctcaactggcaaaaa-tgctgatattgttaggctggatgccatgaccggggttcgaaccccggtacctccact--tgtgtgtgagttta |
16501747 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
16501748 |
taatggctttgccatttcgtctatctacc |
16501776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 525 - 653
Target Start/End: Original strand, 25893853 - 25893979
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| ||||||||| ||| ||||||||||||||||||||||||| |||||||||||||||||||||| || || ||||||| ||||| |
|
|
| T |
25893853 |
cagaagtcctagctcaactggcaaaa--tgctgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccatttgtgtgtgtaagttt |
25893950 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25893951 |
ataatggctttgccatttcgtctatctac |
25893979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 549 - 654
Target Start/End: Complemental strand, 27817553 - 27817448
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27817553 |
aaaatgccgaaattgttagaccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtcta |
27817454 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
27817453 |
tctacc |
27817448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 521 - 653
Target Start/End: Original strand, 37817374 - 37817504
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||| ||||||||||||| ||||||||| || ||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
37817374 |
tatccataagtcctagctcaactggcaaaa--tgacgaaattgttaggtcggatgccatgaccggggttcgaaccccgatacctccacttgtgtgtgtga |
37817471 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
37817472 |
gtttataatggctttgtcatttcgtctatctac |
37817504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 520 - 654
Target Start/End: Original strand, 2442759 - 2442889
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
||||||| ||||||||||||| ||||||||| || ||||||||||||||||||||||||||||||| ||| ||||||||||||| |||| |||||||| |
|
|
| T |
2442759 |
gtatccataagtcctagctcaactggcaaaa--tgtcgaaattgttaggccggatgccatgaccgggattcaaaccccggtacctccact--tgtgtgtg |
2442854 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
2442855 |
agtttataatggctttgccatttcgtctatctacc |
2442889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 521 - 648
Target Start/End: Complemental strand, 7772180 - 7772055
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| |||| |||| ||||||||||||||||||||||| ||||| |||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
7772180 |
tatccagaagtcctagctcaactggtaaaa--tgccgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgtga |
7772083 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||| ||||||||||||||||| |
|
|
| T |
7772082 |
gtttataatgactttgccatttcgtcta |
7772055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 521 - 652
Target Start/End: Complemental strand, 34143484 - 34143355
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||||||||| |||| | |||||| ||||||||||||||||||||||||||||||||||||||| ||| |||||||| ||||||||||||||| |
|
|
| T |
34143484 |
tatccagaagtcctaactcaattagcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcggacctcggtacctccacttatgtgtgtga |
34143387 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |
|
|
| T |
34143386 |
gtttataatagctttgccatttcgtctatcta |
34143355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 88; E-Value: 7e-42
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 33067518 - 33067389
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||| |||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||| |||| ||||||||| |
|
|
| T |
33067518 |
tatccggaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgatcggggttcgaactccggtacctccact--tgtgtgtga |
33067423 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
33067422 |
gtttataatgactttgccatttcgtctatctacc |
33067389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 525 - 654
Target Start/End: Original strand, 26675559 - 26675686
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| |||| |||| |||||||||||||||||||||| ||||||||||||| |||||| ||||||| ||||| ||||||||||||| |
|
|
| T |
26675559 |
cagaagtcctagctcaactggtaaaa--tgccgaaattgttaggccggatatcatgaccggggtttgaaccctggtacctccacttgtgtgtgtgagttt |
26675656 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26675657 |
ataatggctttgccatttcgtctatctacc |
26675686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 5704757 - 5704627
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| ||||||||||||| ||| ||||| || ||||||||||||||| |||||||||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
5704757 |
atccacaagtcctagctcaactgacaaaa--tgtcgaaattgttaggccagatgccatgaccggggtttgaaccccggtacctccacttgtgtgtgtgag |
5704660 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
5704659 |
tttataatggctttgccatttcgtctatatacc |
5704627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 527 - 654
Target Start/End: Original strand, 9569728 - 9569854
Alignment:
| Q |
527 |
gaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag-ttta |
625 |
Q |
| |
|
|||||| ||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || ||||||| |||| |
|
|
| T |
9569728 |
gaagtcttagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgggtgtgagtttta |
9569825 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||| ||||||||||||||||||||||| |
|
|
| T |
9569826 |
taatgactttgccatttcgtctatctacc |
9569854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 11100417 - 11100287
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| ||||| |||||||| | |
|
|
| T |
11100417 |
atccagaagtcctagctcaactgg--aaaaatgccgaaattgttaggccggatgccatgatcggagttcgaaccccggtacctccacttgtgtgtgtggg |
11100320 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||| |||| |||||||||||| |||| |
|
|
| T |
11100319 |
tttataatggttttgtcatttcgtctatttacc |
11100287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 521 - 653
Target Start/End: Complemental strand, 34744396 - 34744266
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||| ||||||| ||||||||| |||||| ||||||||| |||||||||||| || |||||||||| |||||||| ||||||||||||||| |
|
|
| T |
34744396 |
tatccagaagtcatagctcaactggcaaaa--tgccgatattgttagggcggatgccatgatcgtggttcgaacctcggtacctccacttatgtgtgtga |
34744299 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
34744298 |
gtttataatggctttgccattttgtctatctac |
34744266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 35421747 - 35421618
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||| ||| ||||||||| || |||||||||||||||| ||||||||||||||||||||||||| |||||| ||||| ||| |||||| |
|
|
| T |
35421747 |
atccagaagtcctagttcaactggcaaaa--tgtcgaaattgttaggccgaatgccatgaccggggttcgaaccccagtacctccacttgtgt-tgtgag |
35421651 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
35421650 |
tttataatggctttgccatttcgtctatctacc |
35421618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 85; E-Value: 5e-40
Query Start/End: Original strand, 524 - 654
Target Start/End: Complemental strand, 6845110 - 6844984
Alignment:
| Q |
524 |
ccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtt |
623 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| | || ||| |||||||| |
|
|
| T |
6845110 |
ccagaagtcctagctcaattggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaatcccggtacctccgct--tgtatgtgagtt |
6845015 |
T |
 |
| Q |
624 |
tataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6845014 |
tataatggctttgccatttcgtctatctacc |
6844984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 85; E-Value: 5e-40
Query Start/End: Original strand, 549 - 653
Target Start/End: Original strand, 20993561 - 20993665
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||| |||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
20993561 |
aaaatgtcgaaattgttaggccggatgctatgatcggggttcgaaccccggtacctccacttatgtgtgtgagtttataatagctttgccatttcgtcta |
20993660 |
T |
 |
| Q |
649 |
tctac |
653 |
Q |
| |
|
||||| |
|
|
| T |
20993661 |
tctac |
20993665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 9998773 - 9998641
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||| ||||||||||| ||| ||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
9998773 |
tatctagaagtcctagttcaactggcaaaa--tgccgaaattgttaggccggatatcatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
9998676 |
T |
 |
| Q |
621 |
g-tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
9998675 |
gttttataatgactttgccatttcgtctatctacc |
9998641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 6436707 - 6436812
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag-tttataatggctttgccatttcgtct |
647 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6436707 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt-cctccacttgtgtgtgtgagttttataatggctttgccatttcgtct |
6436805 |
T |
 |
| Q |
648 |
atctacc |
654 |
Q |
| |
|
||||||| |
|
|
| T |
6436806 |
atctacc |
6436812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 525 - 654
Target Start/End: Original strand, 14243701 - 14243828
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| |||| |||| ||||||||||||||||| | ||| |||||||| ||||||||||||||||||| || || ||||||||||||| |
|
|
| T |
14243701 |
cagaagtcctagctcaactggtaaaa--tgccgaaattgttaggctgaatgtcatgaccgaggttcgaaccccggtacctccatttgtgtgtgtgagttt |
14243798 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
14243799 |
ataatggctttgccatttcgtctatctacc |
14243828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 548 - 654
Target Start/End: Complemental strand, 17919920 - 17919814
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
17919920 |
aaaaatgtcgatattgttaggccggatgccatgaccggggttcgaacctcggtacctccacttgtgtgtgtgagtttataatggctttgtcatttcgtct |
17919821 |
T |
 |
| Q |
648 |
atctacc |
654 |
Q |
| |
|
||||||| |
|
|
| T |
17919820 |
atctacc |
17919814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 18040134 - 18040265
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||| | ||||||| ||||||||||||||||||| ||||||| | ||||||||||||||||| ||||| ||||||||| |
|
|
| T |
18040134 |
tatccagaagtcctagctcaactg--ataaaatgctgaaattgttaggccggatgtcatgacccagattcgaaccccggtacctccacttgtgtgtgtga |
18040231 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
18040232 |
gtttataatggctttaccatttcgtctatctacc |
18040265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 27545046 - 27544915
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||||| |||||||| ||||||||| || ||||||||||||| |||||| ||| ||||||||||||||||||||||| ||||| || |||||| |
|
|
| T |
27545046 |
tatccagaagttctagctcaactggcaaaa--tgtcgaaattgttaggtcggatgttatgtccggggttcgaaccccggtacctccacttgtgcgtgtga |
27544949 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
27544948 |
gtttataatggctttgccatttcgtctatctacc |
27544915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 16395372 - 16395502
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
|||||||||||||| |||| |||| |||| ||| |||||||||||||||||| | ||||||||||||||||||||||||||| || || |||||||||| |
|
|
| T |
16395372 |
atccagaagtcctaactcaactggtaaaa--tgctgaaattgttaggccggatactatgaccggggttcgaaccccggtacctccatttgtgtgtgtgag |
16395469 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
16395470 |
tttataatgactttgccatttcgtctatctacc |
16395502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 549 - 653
Target Start/End: Original strand, 21530804 - 21530908
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
21530804 |
aaaataccgaaattgttaggtcggatgccatgaccgaggttcgaatcccggtaccttcacttatgtgtgtgagtttataatggttttaccatttcgtcta |
21530903 |
T |
 |
| Q |
649 |
tctac |
653 |
Q |
| |
|
||||| |
|
|
| T |
21530904 |
tctac |
21530908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 522 - 653
Target Start/End: Complemental strand, 40744371 - 40744242
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| || | ||||||||||||| |||||||||||||| |||||||||| |||||| ||||| |||||||||| |
|
|
| T |
40744371 |
atccagaagtcctagctcaactggcaaaa--tgtcaaaattgttaggccagatgccatgaccggagttcgaaccctagtacctccacttgtgtgtgtgag |
40744274 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |
|
|
| T |
40744273 |
tttataatggttttgccatttcgtctatctac |
40744242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 41562441 - 41562573
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcact--tatgtgtgtg |
619 |
Q |
| |
|
||||||||||||||||||| |||| |||| || ||||||||||||||||||||| |||| |||||||||||||||||||||| |||| | |||||||| |
|
|
| T |
41562441 |
atccagaagtcctagctcaactggtaaaa--tgtcgaaattgttaggccggatgctatgatcggggttcgaaccccggtacctccacttgtgtgtgtgtg |
41562538 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
41562539 |
agtttataatggttttgccatttcgtctatctacc |
41562573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 24242715 - 24242582
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg-- |
619 |
Q |
| |
|
|||||||||||||| |||| | |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
24242715 |
atccagaagtcctaactcaaccggcaaaaa-tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgtc |
24242617 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||| ||| ||||| ||||||||||||||||| |
|
|
| T |
24242616 |
agtttacgatgactttgtcatttcgtctatctacc |
24242582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 522 - 653
Target Start/End: Complemental strand, 31941164 - 31941034
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||| ||| ||| ||||||||| ||||||||||||||||| ||||| ||||| |||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
31941164 |
atccagaagtcttagttcaattggcaaaaa-tgccgaaattgttaggctggatgtcatgatcggggttcgaaccccgatacctccacttatgtgtgtgag |
31941066 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||||||||| | ||||||||| |
|
|
| T |
31941065 |
tttataatggctttgccattccatctatctac |
31941034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 528 - 649
Target Start/End: Complemental strand, 44604944 - 44604825
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttata |
627 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||| |||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44604944 |
aagtcctagctcaattggcaaaa--tgccgaaattgttaggtcggatgccatgatcggggttcgaaccccggtacctccacttatgtgtgtgagtttata |
44604847 |
T |
 |
| Q |
628 |
atggctttgccatttcgtctat |
649 |
Q |
| |
|
|| | |||| |||||||||||| |
|
|
| T |
44604846 |
atagttttgtcatttcgtctat |
44604825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 78; E-Value: 7e-36
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 20662546 - 20662651
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| ||||| ||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
20662546 |
aaaatgctgaaattgttaggccggatgccatgaccggggttcgaatgccggtacctccacttgtgtgtgtgagtttataatgactttgtcatttcgtcta |
20662645 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
20662646 |
tctacc |
20662651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 78; E-Value: 7e-36
Query Start/End: Original strand, 521 - 649
Target Start/End: Original strand, 40344488 - 40344613
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||| ||| ||| ||||| ||||||||||||||| ||||||| ||||| |||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
40344488 |
tatccagaagtcctagttcaactgtcaaaa--tgccgaaattgttag-ccggatgtcatgaacggggttcgaaccctggtacctccacttatgtgtgtga |
40344584 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
|||||||||| |||||||||||||||||| |
|
|
| T |
40344585 |
gtttataatgactttgccatttcgtctat |
40344613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 550 - 651
Target Start/End: Complemental strand, 5700752 - 5700649
Alignment:
| Q |
550 |
aaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtg--tgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||| |||||| |||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
5700752 |
aaatgccgaaattgttaggccggatgctatgaccggggttcgaaccccagtacctccacttatgtgtgtgtgagtttataatgactttgccatttcgtct |
5700653 |
T |
 |
| Q |
648 |
atct |
651 |
Q |
| |
|
|||| |
|
|
| T |
5700652 |
atct |
5700649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 525 - 654
Target Start/End: Original strand, 25213631 - 25213757
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag-tt |
623 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||||| ||||||||||||| |||||||||||||||||| ||| |||| |||||||||| || |
|
|
| T |
25213631 |
cagaagtcctagctcaactggcaaaa--tgccgaaattgttagaccggatgccatgatcggggttcgaaccccggtgcctccact--tgtgtgtgagttt |
25213726 |
T |
 |
| Q |
624 |
tataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |
|
|
| T |
25213727 |
tataatggctttgtcatttcgtctatctacc |
25213757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 3054022 - 3054153
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||||| |||||||| ||||||||| ||||||||||||||||||||||||||||| | ||||||||| |||||| ||| ||||| ||||||||| |
|
|
| T |
3054022 |
tatccagaagttctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatga-ctgggttcgaaacccggtgcctccacttgtgtgtgtga |
3054118 |
T |
 |
| Q |
621 |
g-tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
3054119 |
gttttataatggctttgtcatttcgtctatctacc |
3054153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 522 - 652
Target Start/End: Complemental strand, 8547259 - 8547131
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||| |||||| ||| ||||| |||||||| ||| ||||| |||||||||||||||| |
|
|
| T |
8547259 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggtcggatgtcataaccggagttcgaactccgatacctccacttatgtgtgtgag |
8547162 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||| || |||||| |||||||||||||||| |
|
|
| T |
8547161 |
tttacaacggctttaccatttcgtctatcta |
8547131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 523 - 652
Target Start/End: Original strand, 403666 - 403793
Alignment:
| Q |
523 |
tccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagt |
622 |
Q |
| |
|
|||| ||||||||||||| ||| | |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| | ||| ||||| |
|
|
| T |
403666 |
tccacaagtcctagctcaactg--ataaaatgccgaaattgttaggtcggatgccatgaccggggttcgaaccccggtacctctacttgtatgtatgagt |
403763 |
T |
 |
| Q |
623 |
ttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||| |||| ||||||||||||||| |
|
|
| T |
403764 |
ttataatgggtttgtcatttcgtctatcta |
403793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 547 - 653
Target Start/End: Original strand, 43129118 - 43129224
Alignment:
| Q |
547 |
aaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||| |||| |||||||||||| |||| ||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43129118 |
aaaaaataccgaaattgttaggtcggatgccatgatcgggattcgaaccccggcacctccacttgtgtgtgtaagtttataatggctttgccatttcgtc |
43129217 |
T |
 |
| Q |
647 |
tatctac |
653 |
Q |
| |
|
||||||| |
|
|
| T |
43129218 |
tatctac |
43129224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 73; E-Value: 7e-33
Query Start/End: Original strand, 549 - 653
Target Start/End: Complemental strand, 8525305 - 8525201
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||| |||||||||||||||||| || ||||| ||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
8525305 |
aaaatgccgacattgttagaccggatgccatgactggggttcgaaccccggtatctccacttgtgtgtgtgagtttattatggctttgccatttcatcta |
8525206 |
T |
 |
| Q |
649 |
tctac |
653 |
Q |
| |
|
||||| |
|
|
| T |
8525205 |
tctac |
8525201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 73; E-Value: 7e-33
Query Start/End: Original strand, 521 - 652
Target Start/End: Original strand, 35810235 - 35810364
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||| |||| ||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |||| ||||||||| ||||| ||||| | | |
|
|
| T |
35810235 |
tatccacaagttatagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggtttgaactccggtacctccacttttgtgtataa |
35810332 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||| |
|
|
| T |
35810333 |
gtttataatgactttgtcatttcgtctatcta |
35810364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 73; E-Value: 7e-33
Query Start/End: Original strand, 564 - 652
Target Start/End: Original strand, 36055508 - 36055596
Alignment:
| Q |
564 |
ttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| ||||||||||| |||| |
|
|
| T |
36055508 |
ttaggccggatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgagtttataatagctttaccatttcgtctttcta |
36055596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 73; E-Value: 7e-33
Query Start/End: Original strand, 525 - 652
Target Start/End: Complemental strand, 39667021 - 39666896
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
||||||||||| |||| ||| ||||| |||||||||||||||||||||||||||||| | ||||| ||||||| ||||| ||||| ||||| ||||||| |
|
|
| T |
39667021 |
cagaagtcctaactcaactgacaaaa--tgccgaaattgttaggccggatgccatgactgtggttcaaaccccgatacctccacttgtgtgtatgagttt |
39666924 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||||||||| ||||| |
|
|
| T |
39666923 |
ataatggctttgccatttcgtccatcta |
39666896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 522 - 652
Target Start/End: Complemental strand, 5895924 - 5895796
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| ||||||||||||| ||||||||| || |||||||||||||||| |||| |||| |||||||||||||||||||| | || || |||||||||| |
|
|
| T |
5895924 |
atccataagtcctagctcaactggcaaaa--tgtcgaaattgttaggccgaatgctatgatcggggttcgaaccccggtacatccaattgtgtgtgtgag |
5895827 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||| |||| |||||||||||||||| |
|
|
| T |
5895826 |
tttataatgactttaccatttcgtctatcta |
5895796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 525 - 654
Target Start/End: Original strand, 29513878 - 29514004
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| ||| |||| ||||||||||||||||| |||| |||||| ||||||||||||| ||||||| ||||| ||||||||||||| |
|
|
| T |
29513878 |
cagaagtcctagctcaactgacaaa---tgccgaaattgttaggctggataccatgattggggttcgaaccctggtacctccacttgtgtgtgtgagttt |
29513974 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||| ||||||||||||| |||||||||| |
|
|
| T |
29513975 |
ataatagctttgccatttcatctatctacc |
29514004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 549 - 653
Target Start/End: Complemental strand, 32922978 - 32922870
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcact----tatgtgtgtgagtttataatggctttgccatttcg |
644 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |||| | ||||||||||||||||||||||||| ||||||| |
|
|
| T |
32922978 |
aaaatgccgaaattgttaggctggatgccatgaccggggttcgaaccccagtacctccacttgtgtgtgtgtgtgagtttataatggctttgtcatttcg |
32922879 |
T |
 |
| Q |
645 |
tctatctac |
653 |
Q |
| |
|
||||||||| |
|
|
| T |
32922878 |
tctatctac |
32922870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 45406347 - 45406450
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||||||||| || ||||| |||||||||||||| ||||||||||||||||||||||||| || |
|
|
| T |
45406347 |
aaaatgccgaaattgttaggccggatgtcatgatcggggttcgaactccagtaccaccacttatgtgtgtgggtttataatggctttgccatttcgttta |
45406446 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
45406447 |
tcta |
45406450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 522 - 651
Target Start/End: Original strand, 13634845 - 13634972
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||| ||||||| ||||||||| |||||||||||||||| | |||| ||||| ||||||| |||| ||||||||| |||||||||||||||| |
|
|
| T |
13634845 |
atccagaagtcttagctcaactggcaaaa--tgccgaaattgttaggtcagatgtcatgatcggggtttgaactccggtacctccacttatgtgtgtgag |
13634942 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatct |
651 |
Q |
| |
|
||||||||| ||||| ||||| |||||||| |
|
|
| T |
13634943 |
tttataatgactttgtcattttgtctatct |
13634972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 522 - 651
Target Start/End: Original strand, 13735258 - 13735385
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||| ||||||| ||||||||| |||||||||||||||| | |||| ||||| ||||||| |||| ||||||||| |||||||||||||||| |
|
|
| T |
13735258 |
atccagaagtcttagctcaactggcaaaa--tgccgaaattgttaggtcagatgtcatgatcggggtttgaactccggtacctccacttatgtgtgtgag |
13735355 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatct |
651 |
Q |
| |
|
||||||||| ||||| ||||| |||||||| |
|
|
| T |
13735356 |
tttataatgactttgtcattttgtctatct |
13735385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 20150219 - 20150350
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||| |||||||||| ||||||||| || | |||||||||||||||||| ||||||||| |||||||||| ||||| ||||| ||||||||| |
|
|
| T |
20150219 |
tatccagaattcctagctcaactggcaaaa--tgtcaaaattgttaggccggatgtcatgaccggaattcgaaccccaatacctccacttgtgtgtgtga |
20150316 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||| |
|
|
| T |
20150317 |
gtttataatagctttgtcatttcgtctatctacc |
20150350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 2589312 - 2589416
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||||| ||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
2589312 |
aaaatgctgaaattgttaggtcagatgccatgaccggagttcgaaccccggtattttcacttatgtatgtgagtttataatggctttgccattt-gtcta |
2589410 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
2589411 |
tctacc |
2589416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 549 - 654
Target Start/End: Complemental strand, 35497740 - 35497635
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||| |||||||||||||||||| |||| |||||||| ||| ||||||||| ||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35497740 |
aaaatgccaaaattgttaggccggatgttatgatcggggttcaaactccggtacctccacttgtgtgtgtgagtttataatggctttgccattttgtcta |
35497641 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
35497640 |
tctacc |
35497635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 528 - 652
Target Start/End: Original strand, 37953788 - 37953910
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttata |
627 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||||||||||||||||| |||| | ||||||||||||| ||||| ||||||| |||||||||||||| |
|
|
| T |
37953788 |
aagtcctagctcaactgg--aaaaatgtcgaaattgttaggccggatgctatgattgtggttcgaaccccgatacctccacttatatgtgtgagtttata |
37953885 |
T |
 |
| Q |
628 |
atggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||| |||||||||||||||||||| |
|
|
| T |
37953886 |
atgattttgccatttcgtctatcta |
37953910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 26226841 - 26226713
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |||| ||||||||| |
|
|
| T |
26226841 |
tatccagaagtccaagctcagctgg---aaaatgctgaaattgttaggccggatgccatgaccgaggttcgaaccccggtacctccact--tgtgtgtga |
26226747 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||| |||| ||||| |||||||| |||||||| |
|
|
| T |
26226746 |
atttctaataactttgtcatttcgtttatctacc |
26226713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 553 - 653
Target Start/End: Original strand, 36442334 - 36442434
Alignment:
| Q |
553 |
tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||| |||||| ||||| ||||||||||| ||||||||| ||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36442334 |
tgccgaaattgttaggtcggatgtcatgattggggttcgaactccggtacctccacttgtgtgtgtgagtttataatggctttaccatttcgtctatcta |
36442433 |
T |
 |
| Q |
653 |
c |
653 |
Q |
| |
|
| |
|
|
| T |
36442434 |
c |
36442434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 2527200 - 2527329
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||| ||||||| ||||||||| | || ||||||||| |||||||||||| || |||||||||| |||||||||| |||||| ||||||| |
|
|
| T |
2527200 |
tatccagaagtcttagctcaactggcaaaa--tcccaaaattgttaagccggatgccataactggggttcgaatcccggtacctccactta--tgtgtga |
2527295 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||| |
|
|
| T |
2527296 |
gtttataatgactttaccatttcgtctatctacc |
2527329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 526 - 652
Target Start/End: Original strand, 10617788 - 10617911
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||||||||| ||| ||||| |||||| |||||||||||||||| |||||| ||||||||||||||||| ||| ||||| | | |||||||||| |
|
|
| T |
10617788 |
agaagtcctagctcaactgacaaaa--tgccgacattgttaggccggatgtcatgactggggttcgaaccccggt-cctccacttgtatttgtgagttta |
10617884 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||| ||||||||||||||||||||| |
|
|
| T |
10617885 |
taatgactttgccatttcgtctatcta |
10617911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 42650192 - 42650295
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||| |||||||| ||||||||||| ||||||||||||| |||| ||||||||||| |
|
|
| T |
42650192 |
aaaatgccgaaattgttaggtcggatgccatgattggggttcgaacctcggtacctccacttatgtgtatgagtttataatgactttatcatttcgtcta |
42650291 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
42650292 |
tcta |
42650295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 528 - 649
Target Start/End: Original strand, 10006151 - 10006270
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttata |
627 |
Q |
| |
|
||||| ||||||| ||||||||| || | |||||||||| ||||||| ||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10006151 |
aagtcttagctcaactggcaaaa--tgtcaaaattgttagaccggatgtcatgatcggggttcgaaccccagtaccttcacttatgtgtgtgagtttata |
10006248 |
T |
 |
| Q |
628 |
atggctttgccatttcgtctat |
649 |
Q |
| |
|
||| |||| ||||||| ||||| |
|
|
| T |
10006249 |
atgactttaccatttcatctat |
10006270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 555 - 652
Target Start/End: Original strand, 29158828 - 29158930
Alignment:
| Q |
555 |
ccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-----ttatgtgtgtgagtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||||||||||| ||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29158828 |
ccgaaattgttaggccggataccatgatcggggttcgaaccccggtacctccacttgtattttgtgtgtgagtttataatggctttgccatttcgtctat |
29158927 |
T |
 |
| Q |
650 |
cta |
652 |
Q |
| |
|
||| |
|
|
| T |
29158928 |
cta |
29158930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 549 - 654
Target Start/End: Complemental strand, 10926190 - 10926085
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||| |||||| ||| |||||| || |||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
10926190 |
aaaatgccgaaattgttaggtcggatgctatgaccgggattcgaatcccagtacctccatttatgtgtgtgaatttataatggctttatcatttcgtcta |
10926091 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
10926090 |
tctacc |
10926085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 11564997 - 11565129
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||| |||| ||||| |||| |||||||||| ||| |||||||||||||||||||| |||||||| |||||||| ||||||||| ||||| ||||| ||| |
|
|
| T |
11564997 |
tatctagaaatcctaactcaactggcaaaaa-tgctgaaattgttaggccggatgctatgaccggagttcgaactccggtacctccacttgtgtgtttga |
11565095 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| ||||| |||||| |||||||||| |
|
|
| T |
11565096 |
gtttataataactttgtcatttcatctatctacc |
11565129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 17649970 - 17649841
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
|||||||| |||||||||| ||||||||| | |||||||||||| |||||||| ||||| |||| ||||||||||||||||| |||||||| ||||||| |
|
|
| T |
17649970 |
atccagaaatcctagctcaactggcaaaata--ccgaaattgttaagccggatgtcatgatcggg-ttcgaaccccggtacctccacttatgcgtgtgag |
17649874 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||| | ||||| || |||||||||||||| |
|
|
| T |
17649873 |
tttataaagactttgtcaattcgtctatctacc |
17649841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 517 - 652
Target Start/End: Complemental strand, 2508268 - 2508135
Alignment:
| Q |
517 |
atagtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgt |
616 |
Q |
| |
|
||||||||||||||||||| |||| || ||||| |||| ||||||||||| |||||| |||||||||||||||||| ||| ||||| |||| ||||| |
|
|
| T |
2508268 |
atagtatccagaagtcctaactcaactaacaaaa--tgccaaaattgttaggacggatgtcatgaccggggttcgaactccgatacctctacttgtgtgt |
2508171 |
T |
 |
| Q |
617 |
gtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||| |||||| |||||| |||||||| |
|
|
| T |
2508170 |
gtgagtttataatagctttgtcatttcatctatcta |
2508135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 520 - 653
Target Start/End: Original strand, 8569942 - 8570065
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
||||||||||||||||||||| ||||||||| | |||||||||||||||||||||| ||||| ||||||||||||||||||||| |||| ||||||| |
|
|
| T |
8569942 |
gtatccagaagtcctagctcaactggcaaaaga--ccgaaattgttaggccggatgcaatgactggggttcgaaccccggtacctccact--tgtgtgtc |
8570037 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||| ||||||||||||||||||||| |
|
|
| T |
8570038 |
agtttat------tttgccatttcgtctatctac |
8570065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 35222297 - 35222398
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| ||||||||||||| ||||| ||||||||| ||||||||||||||||||| |||||| ||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
35222297 |
aaaatgtcgaaattgttaggtcggataccatgaccgaggttcgaaccccggtacctccactta--tgtgtaagtttgtaatggctttgccatttcgtcta |
35222394 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
35222395 |
tcta |
35222398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 525 - 652
Target Start/End: Original strand, 42922541 - 42922666
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||| ||||||| ||||||||| || |||||||||| | |||||| | ||| ||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
42922541 |
cagaagtcttagctcaactggcaaaa--tgtcgaaattgtttgatcggatgtcgtgatcggggttcgaaccccggtaactccacttatgtgtgtgagttt |
42922638 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||| |||||| ||||||||||||||| |
|
|
| T |
42922639 |
ataatcgctttgtcatttcgtctatcta |
42922666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 531 - 654
Target Start/End: Complemental strand, 3673964 - 3673842
Alignment:
| Q |
531 |
tcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatg |
630 |
Q |
| |
|
|||||||||| |||||||||| || ||||||||||||| | |||||||||||| |||||||||| ||||||| || || ||||||||||||||||||| |
|
|
| T |
3673964 |
tcctagctcaactggcaaaaa-tgtcgaaattgttaggtcatatgccatgaccgtggttcgaaccgcggtaccaccaattgtgtgtgtgagtttataatg |
3673866 |
T |
 |
| Q |
631 |
gctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||| ||||||||||||||||| |
|
|
| T |
3673865 |
actttgtcatttcgtctatctacc |
3673842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 549 - 652
Target Start/End: Complemental strand, 34642541 - 34642438
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||||||| |||||||| | || ||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
34642541 |
aaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaacatcggtacctcaatttgtgtgtgtgagtttataatgactttgtcatttcgtcta |
34642442 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
34642441 |
tcta |
34642438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 40999777 - 40999880
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| ||||||||||| ||||| ||||||||||| ||| ||||| || |||||||| |||||||| |
|
|
| T |
40999777 |
aaaatgtcgaaattgttaggccggatgccatgaccgggattcgaaccccgatacctccacttatgtgtatgactttattataactttgccaattcgtcta |
40999876 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
40999877 |
tcta |
40999880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 4694817 - 4694680
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||| ||||||||||||| ||||||||| || ||||||||||||| |||||| |||||||||| ||| ||||||| ||||| ||||| ||||||||| |
|
|
| T |
4694817 |
tatccataagtcctagctcaactggcaaaa--tgtcgaaattgttaggtcggatgtcatgaccgggattcaaaccccgctacctccacttgtgtgtgtga |
4694720 |
T |
 |
| Q |
621 |
------gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
4694719 |
gtttgagtttataatggctttgccatttcgtctgtctacc |
4694680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 11098203 - 11098073
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
|||||||||||||| |||| ||| ||||| || ||||||||||||| || ||| |||||| ||||||||||||||||| || ||||||| |||||||| |
|
|
| T |
11098203 |
atccagaagtcctaactcaactgacaaaatat--cgaaattgttaggtcgaatgtcatgactggggttcgaaccccggttccaccacttatatgtgtgag |
11098106 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||| |||||| |||||| |||||||||| |
|
|
| T |
11098105 |
tttataattgctttgtcatttcatctatctacc |
11098073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 61; E-Value: 1e-25
Query Start/End: Original strand, 548 - 652
Target Start/End: Original strand, 5917305 - 5917409
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||| ||||| |||||||||||||| ||||||| ||||||||||| ||||||| || || ||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
5917305 |
aaaaatgtcgaaactgttaggccggatgtcatgaccagggttcgaaccatggtacctccatttgtgtgtgtgagtttataatgactttgtcatttcgtct |
5917404 |
T |
 |
| Q |
648 |
atcta |
652 |
Q |
| |
|
||||| |
|
|
| T |
5917405 |
atcta |
5917409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 61; E-Value: 1e-25
Query Start/End: Original strand, 521 - 652
Target Start/End: Complemental strand, 24242028 - 24241899
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||| ||||||| |||| |||| ||| |||||||||||| ||||||||||| ||| |||||||| |||||| || ||||| ||||||||| |
|
|
| T |
24242028 |
tatccagaagtcatagctcaactggtaaaa--tgcagaaattgttaggttggatgccatgatcggagttcgaactccggtatctccacttgtgtgtgtga |
24241931 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||| ||||| ||||||||||||||| |
|
|
| T |
24241930 |
atttataatgactttgtcatttcgtctatcta |
24241899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 549 - 652
Target Start/End: Complemental strand, 36372127 - 36372024
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||||||||||||||| ||||| ||||||| ||||||| ||||||| |||||| ||||||||| | |
|
|
| T |
36372127 |
aaaatgccgaaattgttaggccggatatcatgactggggttcgaaccccgatacctccacttatatgtgtgaatttataacagctttgtcatttcgtcca |
36372028 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
36372027 |
tcta |
36372024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 522 - 636
Target Start/End: Complemental strand, 38216884 - 38216772
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||| ||| ||| ||| |||||||||||||||||||||||| |||| |||||||||||||| ||| ||| || || |||||||||||||||| |
|
|
| T |
38216884 |
atccagaagtcttagttcaactg--aaaaaatgccgaaattgttaggccagatgtcatgaccggggttcaaactccgataactccacttatgtgtgtgag |
38216787 |
T |
 |
| Q |
622 |
tttataatggctttg |
636 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
38216786 |
tttataatgactttg |
38216772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 521 - 653
Target Start/End: Original strand, 15129635 - 15129762
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| | ||||||| |||| ||||||||||| | |||||||||| || |||||||||| || ||||| ||||| |||||||| |
|
|
| T |
15129635 |
tatccagaagtcctagctcaaccggcaaaa--tgccaaaattgttaggtctgatgccatgatcgaggttcgaacctcg-tacctccactt--gtgtgtga |
15129729 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| |
|
|
| T |
15129730 |
gtttataatagctttgtcatttcgtctatctac |
15129762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 23554868 - 23554999
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||| |||||||||| |||| |||| ||||||||||||||| || ||| ||||| | ||||||| |||| ||||||| ||||| || |||||| |
|
|
| T |
23554868 |
tatccagaaatcctagctcaactggtaaaa--tgccgaaattgttagatcgaatgtcatgatcagggttcggaccctggtacctccacttgtgcgtgtga |
23554965 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
23554966 |
atttataatggttttgccatttcgtctatctacc |
23554999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 526 - 647
Target Start/End: Original strand, 41278604 - 41278723
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||| ||||||| ||||||||| | || |||||||||||| |||||| ||||| || |||||||||||| ||||| ||||| ||||||||||||| |
|
|
| T |
41278604 |
agaagtcttagctcaactggcaaaata--ccaaaattgttaggctggatgctatgactggagttcgaaccccgatacctccacttttgtgtgtgagtttt |
41278701 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtct |
647 |
Q |
| |
|
|||||| ||||||||||||||| |
|
|
| T |
41278702 |
taatggttttgccatttcgtct |
41278723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 522 - 602
Target Start/End: Original strand, 43820867 - 43820945
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtac |
602 |
Q |
| |
|
|||||||||||||| |||| ||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43820867 |
atccagaagtcctaactcaactggcaaaa--tgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtac |
43820945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 562 - 646
Target Start/End: Original strand, 7882894 - 7882977
Alignment:
| Q |
562 |
tgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
|||||||||||||| |||||| || ||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7882894 |
tgttaggccggatgtgatgaccagg-ttcgaactctggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtc |
7882977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 549 - 653
Target Start/End: Complemental strand, 26732978 - 26732874
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| |||||||| |||| |||||| ||||| ||||||||||||||| |||||| ||||| ||||| ||| |||||||||||||| |||||||| ||| |
|
|
| T |
26732978 |
aaaatgtcgaaattgctaggtcggatgtcatgatcggggttcgaaccccagtacctccacttgtgtgtttgaatttataatggctttaccatttcgacta |
26732879 |
T |
 |
| Q |
649 |
tctac |
653 |
Q |
| |
|
||||| |
|
|
| T |
26732878 |
tctac |
26732874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 521 - 649
Target Start/End: Original strand, 42158556 - 42158683
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||| ||||||||||||| ||| |||| ||||||||||||||| ||| || |||||||| |||||||||| |||||||| ||||||||||||||| |
|
|
| T |
42158556 |
tatccacaagtcctagctcaattggtaaaa-atgccgaaattgttaaaccgaataccatgaccaaggttcgaacctcggtacctccacttatgtgtgtga |
42158654 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
|||||||||| || | | ||||||||||| |
|
|
| T |
42158655 |
gtttataatgactatacaatttcgtctat |
42158683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 522 - 650
Target Start/End: Complemental strand, 10286594 - 10286468
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| || | |||||||||| ||| || || ||| ||| |||||||||||||| || ||||| | |||||||| |
|
|
| T |
10286594 |
atccagaagtcctagctcaactggcaaaa--tgtcaaaattgttagaccgaataccgtgattgggattcgaaccccggtatctccacttgtatgtgtgag |
10286497 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatc |
650 |
Q |
| |
|
||||||||| ||||| ||||||||||||| |
|
|
| T |
10286496 |
tttataatgactttgtcatttcgtctatc |
10286468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 520 - 652
Target Start/End: Original strand, 41897821 - 41897951
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
|||| ||||||||||| |||| ||| ||||| | ||||||||||||||||||||| ||| || ||| ||| ||||||| ||| | |||||||||||||| |
|
|
| T |
41897821 |
gtattcagaagtcctaactcaactgacaaaata--ccgaaattgttaggccggatgtcataactgggattcaaaccccgatacttccacttatgtgtgtg |
41897918 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| |
|
|
| T |
41897919 |
agtttataataattttgtcatttcgtctatcta |
41897951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 549 - 653
Target Start/End: Original strand, 8971829 - 8971933
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| | ||||||||| |||||||| ||||||| |||| ||| || ||||||||||||| ||||||||| |||| |||| ||||||||||||||||| |
|
|
| T |
8971829 |
aaaatgtcaaaattgttaagccggatgttatgaccgaggtttgaatcctggtaccttcacttgtgtgtgtgaatttacaatgactttgccatttcgtcta |
8971928 |
T |
 |
| Q |
649 |
tctac |
653 |
Q |
| |
|
||||| |
|
|
| T |
8971929 |
tctac |
8971933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 583 - 654
Target Start/End: Original strand, 36054029 - 36054101
Alignment:
| Q |
583 |
cggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgcca-tttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
36054029 |
cggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggttttgccattttcgtctatctacc |
36054101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 557 - 647
Target Start/End: Original strand, 1766740 - 1766833
Alignment:
| Q |
557 |
gaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttc---acttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
|||||||||||| ||||||| |||||| ||||||||||||||||||| | |||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1766740 |
gaaattgttaggtcggatgctgtgaccgaggttcgaaccccggtacctcctccacttgtgtgtgtaagtttataatggctttgccatttcgtct |
1766833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 549 - 652
Target Start/End: Complemental strand, 43105982 - 43105880
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||| ||||||||||||| ||| |||| || ||||||||||||||||||| ||||| |||||| |||| |
|
|
| T |
43105982 |
aaaatgccgaaattgttaggccg-atgttatgaccagggttcgaaccccaatactttcatttgtgtgtgtgagtttataatgactttgtcatttcatcta |
43105884 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
43105883 |
tcta |
43105880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 548 - 649
Target Start/End: Complemental strand, 28183816 - 28183714
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
||||||||||||||| ||||||||||| | |||||||||||||||||||| |||| ||| || |||||||||||||||||||||||| |||||| || |
|
|
| T |
28183816 |
aaaaatgccgaaattattaggccggatttcttgaccggggttcgaaccccgacacctccactttgtgtgtgtgagtttataatggctttatcatttcttc |
28183717 |
T |
 |
| Q |
647 |
tat |
649 |
Q |
| |
|
||| |
|
|
| T |
28183716 |
tat |
28183714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 522 - 625
Target Start/End: Complemental strand, 38017303 - 38017204
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| ||||| ||||||| |||| ||||||||||||||| ||| |||||||| |||||| ||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
38017303 |
atccaaaagtcatagctcaactgg--aaaaatgccgaaattattaagccggatgtcatgacgggggttcgaaccccggtacctccact--tgtgtgtgag |
38017208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 528 - 643
Target Start/End: Original strand, 40216783 - 40216899
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaa-ttgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||||||| |||||||||| |||||||| ||||||||||||||| | ||| ||||||||||| || || |||| ||| || |||||||||||||| |
|
|
| T |
40216783 |
aagtcctagctcaactggcaaaaa-tgccgaaaattgttaggccggatgtcttgatcggggttcgaatcctggcacctccactttgtgtgtgtgagttta |
40216881 |
T |
 |
| Q |
626 |
taatggctttgccatttc |
643 |
Q |
| |
|
| ||||||||| |||||| |
|
|
| T |
40216882 |
tgatggctttgtcatttc |
40216899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 521 - 653
Target Start/End: Original strand, 43167137 - 43167267
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||| ||||||| ||||||| ||| | |||||| ||||||||| ||| |||| ||||| |||||||||||||||| ||||| ||||| |||||| | |
|
|
| T |
43167137 |
tatctagaagtcatagctcaactg--ataaaatgtcgaaattgtaaggtttgatgtcatgatcggggttcgaaccccgatacctccacttgcgtgtgtca |
43167234 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||| |||| |||||||||||||||| |
|
|
| T |
43167235 |
gtttataatggttttgtcatttcgtctatctac |
43167267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 522 - 653
Target Start/End: Complemental strand, 3728455 - 3728318
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg-- |
619 |
Q |
| |
|
|||||||||||| |||||| ||| ||||| || ||||||||||||| |||||| ||||| ||||||||||||||| ||||| ||||| |||||||| |
|
|
| T |
3728455 |
atccagaagtcccagctcaactgacaaaatat--cgaaattgttaggtcggatgtcatgattggggttcgaaccccgatacctccacttgtgtgtgtgtg |
3728358 |
T |
 |
| Q |
620 |
------agtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
3728357 |
tgagtttgtttataatgactttgccatttcgtctatctac |
3728318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 548 - 654
Target Start/End: Original strand, 14258327 - 14258429
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||| |||||||||||| ||||||| |||||||||||||||| | |||||||| |||||| ||||||||||||||||| ||||| || ||||||| |
|
|
| T |
14258327 |
aaaaatgttgaaattgttaggtcggatgctatgaccggggttcgaa-cacggtacctccactta--tgtgtgagtttataatgactttgtca-ttcgtct |
14258422 |
T |
 |
| Q |
648 |
atctacc |
654 |
Q |
| |
|
||||||| |
|
|
| T |
14258423 |
atctacc |
14258429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 557 - 650
Target Start/End: Complemental strand, 20099746 - 20099655
Alignment:
| Q |
557 |
gaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatc |
650 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||| | ||||| ||||||| ||||||||||||||| |||||||||||||| |||| |
|
|
| T |
20099746 |
gaaattgttaggccggatgccatgaccgaggtttgaacctcaatacctctacttatg--tgtgagtttataatgactttgccatttcgtttatc |
20099655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 528 - 640
Target Start/End: Original strand, 14725774 - 14725884
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttata |
627 |
Q |
| |
|
||||||||||||| ||| | |||||| ||||||| ||||||| ||| ||||| ||| |||||||||| | ||||| ||||| |||||||||||||||| |
|
|
| T |
14725774 |
aagtcctagctcaactg--ataaaatgtcgaaattattaggccagatatcatgatcggagttcgaaccctgatacctccacttgtgtgtgtgagtttata |
14725871 |
T |
 |
| Q |
628 |
atggctttgccat |
640 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
14725872 |
atggatttgccat |
14725884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 549 - 653
Target Start/End: Complemental strand, 12927330 - 12927227
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||| |||||||||| |||| | ||||||| | |||||||||| ||||||| | ||||| ||||| ||||||||||||| |||||||||||| || | |
|
|
| T |
12927330 |
aaaatgctgaaattgttatgccgtacgccatgatcagggttcgaactccggtacatccacttgtgtgt-tgagtttataatgactttgccatttcatcga |
12927232 |
T |
 |
| Q |
649 |
tctac |
653 |
Q |
| |
|
||||| |
|
|
| T |
12927231 |
tctac |
12927227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 556 - 648
Target Start/End: Complemental strand, 31665209 - 31665117
Alignment:
| Q |
556 |
cgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||| | | ||||| ||||||||||| | |||||||| ||| ||||||| | ||||||||||| ||||||||||| ||||| |
|
|
| T |
31665209 |
cgaaattgttaggccgaacgtcatgatcggggttcgaatctcggtacctccacatatgtgtattagtttataatgactttgccattttgtcta |
31665117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 548 - 631
Target Start/End: Original strand, 40418151 - 40418235
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttataatgg |
631 |
Q |
| |
|
|||||||| |||||||||||||| || | ||||||||| |||||||||||| ||||| ||| |||||||||||||||||| |||| |
|
|
| T |
40418151 |
aaaaatgctgaaattgttaggccagacgtcatgaccggagttcgaaccccgatacctccactttatgtgtgtgagtttatgatgg |
40418235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 523 - 645
Target Start/End: Complemental strand, 41746776 - 41746658
Alignment:
| Q |
523 |
tccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagt |
622 |
Q |
| |
|
|||||||||||||||||| ||| ||||| |||| ||||| |||||||||||||||||| |||||||||||| | ||| | | |||| || |||||||| |
|
|
| T |
41746776 |
tccagaagtcctagctcaactgacaaaa--tgccaaaattattaggccggatgccatgatcggggttcgaactctggtccttccact--tgcgtgtgagt |
41746681 |
T |
 |
| Q |
623 |
ttataatggctttgccatttcgt |
645 |
Q |
| |
|
|||||| | ||||| |||||||| |
|
|
| T |
41746680 |
ttataaagactttgtcatttcgt |
41746658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 579 - 653
Target Start/End: Original strand, 33286337 - 33286414
Alignment:
| Q |
579 |
tgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt---ataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||||||||||||| |||| ||||| ||||||||||||| ||||| |||||| |||||||||||||||| |
|
|
| T |
33286337 |
tgaccggggttcgaaccccggcacctccacttgtgtgtgtgagtttataataatagctttgtcatttcgtctatctac |
33286414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 593 - 652
Target Start/End: Complemental strand, 43748861 - 43748802
Alignment:
| Q |
593 |
accccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
43748861 |
accccggtacctccacttgtgtgtgtgagtttataatgactttgctatttcgtctatcta |
43748802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 528 - 629
Target Start/End: Complemental strand, 7432618 - 7432519
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttata |
627 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||| ||||| | ||||| |||| ||||||| | ||||||| ||||||||||| ||| |||||| |
|
|
| T |
7432618 |
aagtcctagctcaactggcaaaa--tgccgaaattgttaaaccggacgtcatgatcgggattcgaactctggtacctccacttatgtgtatgaatttata |
7432521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 556 - 654
Target Start/End: Complemental strand, 13403515 - 13403418
Alignment:
| Q |
556 |
cgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||| | | | ||| ||||| |||||||||||||||||| ||||| ||||||||||||||| |||| ||| |||| || |||||||||| |
|
|
| T |
13403515 |
cgaaattgttaggctgaacgtcataaccggagttcgaaccccggtacctccactt-tgtgtgtgagtttatgatggtttttccatctcttctatctacc |
13403418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 517 - 653
Target Start/End: Original strand, 14725298 - 14725430
Alignment:
| Q |
517 |
atagtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgt |
616 |
Q |
| |
|
|||| ||||| || |||||||||| ||| | |||||| |||||||||||||||| ||| |||| |||||||| || | ||||||||||| |||| |
|
|
| T |
14725298 |
atagaatccacaaatcctagctcaactg--ataaaatgtcgaaattgttaggccgtatgttatgatcggggttcaaattctaataccttcactt--gtgt |
14725393 |
T |
 |
| Q |
617 |
gtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
14725394 |
gtgagtttataatgactttgtcatttcgtctatctac |
14725430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 521 - 610
Target Start/End: Complemental strand, 20990543 - 20990456
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcactt |
610 |
Q |
| |
|
||||||||||| |||||||| ||||||||| |||||| ||||||||| |||||| ||||||| ||||||||||||| | |||| ||||| |
|
|
| T |
20990543 |
tatccagaagttctagctcaactggcaaaa--tgccgacattgttaggtcggatgtcatgaccagggttcgaaccccagaacctccactt |
20990456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 22762028 - 22762134
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacct-tcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||| || ||||||||| |||||||| ||||| ||||| | ||||||||||| ||||| |||||| ||| |
|
|
| T |
22762028 |
aaaatgccgaaattgttaggtcggatgtcatgatcgaagttcgaacctcggtacctaccacttgtgtgtataagtttataatgtctttgtcatttcatct |
22762127 |
T |
 |
| Q |
648 |
atctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
22762128 |
gtctacc |
22762134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 36482186 - 36482056
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||| ||||| | ||| | |||||| |||||||||||||||| |||| |||| |||||||||||| ||| | ||| || || | ||||||| |
|
|
| T |
36482186 |
tatccagaagtcttagcttaactg--ataaaatgtcgaaattgttaggccgaatgctatgatcggggttcgaactccgatgcctcca-ttttatgtgtga |
36482090 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||| ||||| ||||||| |||||||| |
|
|
| T |
36482089 |
gtttataatgattttgctatttcgtttatctacc |
36482056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 557 - 652
Target Start/End: Complemental strand, 5682319 - 5682218
Alignment:
| Q |
557 |
gaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac---ttatgtgtgtgagttt---ataatggctttgccatttcgtctatc |
650 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||||||| ||||| ||| || ||||||||||||| ||||||||||||| ||||||||| || |
|
|
| T |
5682319 |
gaaattgttaggccggatgttatgaccggagttcgaaccccgatacctccactaattgtgtgtgtgagtttataataatggctttgctatttcgtctttc |
5682220 |
T |
 |
| Q |
651 |
ta |
652 |
Q |
| |
|
|| |
|
|
| T |
5682219 |
ta |
5682218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 580 - 649
Target Start/End: Complemental strand, 24420073 - 24420005
Alignment:
| Q |
580 |
gaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
24420073 |
gaccggagttcgaaccccggtaccc-cacttatctgtgtgagtttataataactttgccatttcgtctat |
24420005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 548 - 652
Target Start/End: Original strand, 31291242 - 31291347
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttca-cttatgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
|||||||||||||||||||||||| | | ||||| |||||||||||| |||||||||| || ||| ||||||||||| |||| |||| ||| ||||| |
|
|
| T |
31291242 |
aaaaatgccgaaattgttaggccgaacgtcatgatcggggttcgaactttggtaccttcattttgtgtttgtgagtttatgatggttttgtcatctcgtc |
31291341 |
T |
 |
| Q |
647 |
tatcta |
652 |
Q |
| |
|
|||||| |
|
|
| T |
31291342 |
tatcta |
31291347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 548 - 652
Target Start/End: Complemental strand, 33128270 - 33128165
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
|||||||| ||||||||||||||| | | ||||| |||||||||||||||||||||| ||| || ||| ||||||||||| ||| |||| ||| || || |
|
|
| T |
33128270 |
aaaaatgctgaaattgttaggccgaacgtcatgatcggggttcgaaccccggtacctccactttgtgtatgtgagtttattatgcatttgtcatctcatc |
33128171 |
T |
 |
| Q |
647 |
tatcta |
652 |
Q |
| |
|
|||||| |
|
|
| T |
33128170 |
tatcta |
33128165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 548 - 604
Target Start/End: Complemental strand, 25899287 - 25899231
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacct |
604 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||| ||||| |||||||| |
|
|
| T |
25899287 |
aaaaatgccgaaattgttaggccggacgtcatgaccggggtttgaacctcggtacct |
25899231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 525 - 617
Target Start/End: Original strand, 30089960 - 30090051
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtg |
617 |
Q |
| |
|
|||||||| ||||||| || |||||| |||||||||||||||| ||| ||||||||| |||||||||||||| |||| || |||| |||||| |
|
|
| T |
30089960 |
cagaagtcatagctcaacttgcaaaa-atgccgaaattgttagcccgaatgccatgatcggggttcgaacccaagtacatttacttgtgtgtg |
30090051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 528 - 654
Target Start/End: Original strand, 1522697 - 1522822
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttat |
626 |
Q |
| |
|
||||||||||||| |||||||||| | ||||||||||||||||||| ||||| ||||||||||||| | ||||| ||| ||| ||||||||| ||| |
|
|
| T |
1522697 |
aagtcctagctcaactggcaaaaa-taccgaaattgttaggccggacttcatgatcggggttcgaacctccatacctccactttacgtgtgtgag-ttac |
1522794 |
T |
 |
| Q |
627 |
aatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||| || ||||| |||| |
|
|
| T |
1522795 |
gatggctttgccatctcttctatttacc |
1522822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 548 - 634
Target Start/End: Original strand, 11021360 - 11021447
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttataatggctt |
634 |
Q |
| |
|
||||||| ||||||| ||||| |||| | ||||||| | |||||||||||||||||| ||| || ||||||||||||||| ||||||| |
|
|
| T |
11021360 |
aaaaatgtcgaaattattaggtcggacgtcatgacctgagttcgaaccccggtacctccactttgtgtgtgtgagtttatgatggctt |
11021447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 519 - 590
Target Start/End: Original strand, 16816821 - 16816891
Alignment:
| Q |
519 |
agtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttc |
590 |
Q |
| |
|
||||| ||||| |||||||||| |||||||||| || |||||||||||||||| ||||||| |||||||||| |
|
|
| T |
16816821 |
agtattcagaactcctagctcaactggcaaaaa-tgtcgaaattgttaggccgaatgccataaccggggttc |
16816891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 521 - 596
Target Start/End: Complemental strand, 29845215 - 29845142
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
596 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| | |||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
29845215 |
tatccagaagtcctagttcaactggcaaaaa-tatcgaaattgttaggc-ggatgccatgatcggggttcgaaccc |
29845142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 577 - 652
Target Start/End: Complemental strand, 35058932 - 35058857
Alignment:
| Q |
577 |
catgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||| ||| |||||||||| |||||| ||||| |||||||||||||||||| | ||||| |||||||||||||| |
|
|
| T |
35058932 |
catgatcggagttcgaaccctagtacctccacttgtgtgtgtgagtttataatagttttgctatttcgtctatcta |
35058857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 590 - 649
Target Start/End: Complemental strand, 42007394 - 42007335
Alignment:
| Q |
590 |
cgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||| ||||| |||| |||||||||||| |
|
|
| T |
42007394 |
cgaatcccggtacctccacttatgtgtgtgagtttacaatggttttgtcatttcgtctat |
42007335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 604 - 654
Target Start/End: Complemental strand, 7376347 - 7376297
Alignment:
| Q |
604 |
ttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||| ||| | |||||||||||||||||||||| |
|
|
| T |
7376347 |
ttcacttatgtgtgtgagtttacaattgttttgccatttcgtctatctacc |
7376297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 599 - 653
Target Start/End: Complemental strand, 11407296 - 11407242
Alignment:
| Q |
599 |
gtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
11407296 |
gtacctccacttgtgtgtgtgagtttataatggcttagccattttgtctatctac |
11407242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 548 - 654
Target Start/End: Complemental strand, 15589359 - 15589254
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||| |||||||| |||||||| || ||||||||| |||||||||| ||||| ||||| | ||||||||||||| ||| |||| ||| |||||| |
|
|
| T |
15589359 |
aaaaatgacgaaattgataggccggttgtcatgaccggaattcgaacccctatacctccactt-tatgtgtgagtttatgatgaatttgtcatctcgtct |
15589261 |
T |
 |
| Q |
648 |
atctacc |
654 |
Q |
| |
|
||||||| |
|
|
| T |
15589260 |
atctacc |
15589254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 522 - 618
Target Start/End: Complemental strand, 11265185 - 11265091
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgt |
618 |
Q |
| |
|
||||||||||||||| ||| ||| ||||| || | |||||||||||||||||||| ||| ||| ||| ||| ||||||||| ||||||||||||| |
|
|
| T |
11265185 |
atccagaagtcctagttcaactgacaaaa--tgtcaaaattgttaggccggatgccgtgatcggaattcaaactccggtacctccacttatgtgtgt |
11265091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 549 - 602
Target Start/End: Complemental strand, 31261059 - 31261006
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtac |
602 |
Q |
| |
|
|||||| ||||||||||||| |||| ||||||| |||||||||||||||||||| |
|
|
| T |
31261059 |
aaaatgtcgaaattgttaggtcggacgccatgatcggggttcgaaccccggtac |
31261006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 522 - 650
Target Start/End: Original strand, 39333944 - 39334069
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| ||||||||||| | ||||||||| ||| || ||||||||||||||| |||||| || ||| | | ||||| ||||||||||||| |||| |
|
|
| T |
39333944 |
atccacaagtcctagcttaactggcaaaa--tgctaaacttgttaggccggatgtcatgac-ggaattcaagcatcggtattttcacttatgtgtttgag |
39334040 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatc |
650 |
Q |
| |
|
|||||||||| |||| ||||||||||||| |
|
|
| T |
39334041 |
tttataatggttttgtcatttcgtctatc |
39334069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 608 - 652
Target Start/End: Complemental strand, 29844206 - 29844163
Alignment:
| Q |
608 |
cttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29844206 |
cttatgtgtgtgagtttataatggcttt-ccatttcgtctatcta |
29844163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 558 - 653
Target Start/End: Complemental strand, 39068498 - 39068405
Alignment:
| Q |
558 |
aaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||| | | ||||| | || |||||||| | ||||| ||||| |||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39068498 |
aaattgttaggccgaacgtcatgatcaggattcgaacctcaatacctccactt--gtgtatgagtttataatggctttgtcatttcgtctatctac |
39068405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 43330640 - 43330740
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||| ||||||||||||| || |||||| |||| ||||||| | | ||||||| ||||||| ||||||||||||||||||| |||||| |||| |
|
|
| T |
43330640 |
aaaatgccaaaattgttaggccagacaccatgatcggg-ttcgaactctgtcaccttcatttatgtg--tgagtttataatggctttgtcatttcatcta |
43330736 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
43330737 |
tcta |
43330740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 548 - 626
Target Start/End: Complemental strand, 11109962 - 11109883
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttat |
626 |
Q |
| |
|
||||||||| ||||||||| || ||| | |||||| |||||||||||||||||| || ||| |||||||||| ||||||| |
|
|
| T |
11109962 |
aaaaatgccaaaattgttaagctggacgtcatgactggggttcgaaccccggtatctccactttatgtgtgttagtttat |
11109883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 549 - 631
Target Start/End: Original strand, 612505 - 612587
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatgg |
631 |
Q |
| |
|
||||||||||||||| ||||| ||||| ||||| |||| ||| ||||||| |||| |||| ||||||| |||||||||||| |
|
|
| T |
612505 |
aaaatgccgaaattggtaggctggatgtcatgatcgggattcaaaccccgacacctctacttgtgtgtgtaagtttataatgg |
612587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 549 - 631
Target Start/End: Original strand, 618899 - 618981
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatgg |
631 |
Q |
| |
|
||||||||||||||| ||||| ||||| ||||| |||| ||| ||||||| |||| |||| ||||||| |||||||||||| |
|
|
| T |
618899 |
aaaatgccgaaattggtaggctggatgtcatgatcgggattcaaaccccgacacctctacttgtgtgtgtaagtttataatgg |
618981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 559 - 652
Target Start/End: Complemental strand, 14138876 - 14138786
Alignment:
| Q |
559 |
aattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||| ||||||| |||||| || |||| ||||| ||||||| ||||| |||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
14138876 |
aattgttatgccggataccatgatcgtggtttgaacct-ggtacctccactt--gtgtgtgagtttataatggctttgtcatttcctctgtcta |
14138786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 614 - 654
Target Start/End: Complemental strand, 39443137 - 39443096
Alignment:
| Q |
614 |
tgtgtgagttt-ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39443137 |
tgtgtgagttttataatggctttgccatttcgtctatctacc |
39443096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 526 - 596
Target Start/End: Complemental strand, 6602642 - 6602575
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
596 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| |||||||| | ||||||| |||||||||||| |
|
|
| T |
6602642 |
agaagtcctagctcaactggcaaa---tgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
6602575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 526 - 596
Target Start/End: Complemental strand, 6678095 - 6678028
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
596 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| |||||||| | ||||||| |||||||||||| |
|
|
| T |
6678095 |
agaagtcctagctcaactggcaaa---tgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
6678028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 526 - 654
Target Start/End: Complemental strand, 12702423 - 12702295
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||||||||| |||| ||| | ||||||||||||||||||| ||| |||| | |||||||||||| ||| ||||| ||||| ||| |||| |
|
|
| T |
12702423 |
agaagtcctagctcaactggttaaata--ccgaaattgttaggccggacgccttgacggaggttcgaacccccacccctccacttgtgtgtctgaattta |
12702326 |
T |
 |
| Q |
626 |
taatggctt--tgccatttcgtctatctacc |
654 |
Q |
| |
|
||||| || || ||||||||||||||||| |
|
|
| T |
12702325 |
taatgattttgtgtcatttcgtctatctacc |
12702295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 614 - 654
Target Start/End: Original strand, 33540242 - 33540282
Alignment:
| Q |
614 |
tgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
33540242 |
tgtgtgagtttatgatggctttgccatctcgtctatctacc |
33540282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 585 - 652
Target Start/End: Original strand, 21174620 - 21174687
Alignment:
| Q |
585 |
gggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||| |||||| || || ||||||||||||| || |||||||| ||||| ||||||||||||||| |
|
|
| T |
21174620 |
gggttctaaccccaatatctccacttatgtgtgttaggttataatgactttgtcatttcgtctatcta |
21174687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 528 - 653
Target Start/End: Complemental strand, 24197952 - 24197827
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcactt-atgtgtgtgagtttat |
626 |
Q |
| |
|
|||||||| |||| |||||||||| || ||||||| ||||| | || ||||| | || ||||||| ||| ||||| ||||| |||||||||||||||| |
|
|
| T |
24197952 |
aagtcctatctcaactggcaaaaa-tgtcgaaattattaggtctgacaacatgatcaggattcgaactccgatacctccactttatgtgtgtgagtttat |
24197854 |
T |
 |
| Q |
627 |
aatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||| |||| ||| || ||||||||| |
|
|
| T |
24197853 |
gatggttttgtcatctcttctatctac |
24197827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 588 - 646
Target Start/End: Original strand, 29030629 - 29030687
Alignment:
| Q |
588 |
ttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
||||||| ||||||| ||||||||||||||| | ||||||||| |||| ||||||||| |
|
|
| T |
29030629 |
ttcgaactccggtactttcacttatgtgtgtaaatttataatgactttctcatttcgtc |
29030687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 614 - 652
Target Start/End: Original strand, 35058414 - 35058452
Alignment:
| Q |
614 |
tgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
35058414 |
tgtgtgagtttataatgactttgtcatttcgtctatcta |
35058452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 551 - 600
Target Start/End: Original strand, 2795454 - 2795503
Alignment:
| Q |
551 |
aatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggt |
600 |
Q |
| |
|
|||||| |||||| ||||||||||||| ||||||||||| |||| ||||| |
|
|
| T |
2795454 |
aatgcccaaattgctaggccggatgccgtgaccggggtttgaactccggt |
2795503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 548 - 585
Target Start/End: Complemental strand, 36442792 - 36442755
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccgg |
585 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
36442792 |
aaaaatgccgaaattgttaggccggacgtcatgaccgg |
36442755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 548 - 640
Target Start/End: Complemental strand, 39709729 - 39709636
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcactt-atgtgtgtgagtttataatggctttgccat |
640 |
Q |
| |
|
||||||| |||||||||||| ||||| | | |||| ||||||| ||| | | ||||| ||||| || ||||||||||||| |||| |||||||| |
|
|
| T |
39709729 |
aaaaatgtcgaaattgttagaccggacgtcgtgactggggttcaaactctgatacctccactttatatgtgtgagtttatgatggttttgccat |
39709636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 107; Significance: 3e-53; HSPs: 176)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 3e-53
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 7512765 - 7512896
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
7512765 |
tatccagaagtcctagctcaactggcaaaa--tgccaaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
7512862 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
7512863 |
gtttataatggctttgccatttcgtctatctacc |
7512896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 106; E-Value: 1e-52
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 30044713 - 30044583
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
30044713 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgag |
30044616 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30044615 |
tttataatggctttgccatttcgtctatctacc |
30044583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 106; E-Value: 1e-52
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 49882838 - 49882708
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
49882838 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccgaggttcgaaccccggtacctccacttgtgtgtgtgag |
49882741 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
49882740 |
tttataatggctttgccatttcgtctatctacc |
49882708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 103; E-Value: 8e-51
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 12821164 - 12821292
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
12821164 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccact--tgtgtgtgag |
12821259 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
12821260 |
tttataatggctttgccatttcgtctatctacc |
12821292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 103; E-Value: 8e-51
Query Start/End: Original strand, 523 - 652
Target Start/End: Complemental strand, 42412116 - 42411989
Alignment:
| Q |
523 |
tccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagt |
622 |
Q |
| |
|
|||||||||| ||||||| ||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42412116 |
tccagaagtcatagctcaactggcaaaa--tgccgaaattgttaggccagatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgagt |
42412019 |
T |
 |
| Q |
623 |
ttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42412018 |
ttataatggctttgccatttcgtctatcta |
42411989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 103; E-Value: 8e-51
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 46488247 - 46488116
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||| ||||||||||||| ||||| ||||||||| |
|
|
| T |
46488247 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgaccggggttcaaaccccggtacctccacttgtgtgtgtga |
46488150 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
46488149 |
gtttataatggctttgccatttcgtctatctacc |
46488116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 102; E-Value: 3e-50
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 5397069 - 5396939
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
5397069 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
5396972 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
5396971 |
tttataatggctttgccatttcgtgtatctacc |
5396939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 102; E-Value: 3e-50
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 13389019 - 13389149
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||| |||||||||||| |||||| |||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
13389019 |
atccagaagtcctagctcaactggcaaaa--tgctgaaattgttaggtcggatgtcatgaccggggttcgaaccccggtacctccacttatgtgtgtgag |
13389116 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
13389117 |
tttataatggctttgccatttcgtctatctacc |
13389149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 102; E-Value: 3e-50
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 31263630 - 31263500
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| || ||||||| |||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31263630 |
atccagaagtcctagctcaactggcaaaa--tgtcgaaattattagaccggatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgag |
31263533 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
31263532 |
tttataatggctttgccatttcgtctatctacc |
31263500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 101; E-Value: 1e-49
Query Start/End: Original strand, 521 - 652
Target Start/End: Original strand, 9569473 - 9569602
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||| ||||||| ||||| ||||||||| |
|
|
| T |
9569473 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgaccggggttcgaaccctggtacctccacttgtgtgtgtga |
9569570 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
9569571 |
gtttataatggctttgccatttcgtctatcta |
9569602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 101; E-Value: 1e-49
Query Start/End: Original strand, 522 - 653
Target Start/End: Original strand, 24712087 - 24712216
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||| |||||| |||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
24712087 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
24712184 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
24712185 |
tttataatggctttgccatttcgtctatctac |
24712216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 100; E-Value: 5e-49
Query Start/End: Original strand, 521 - 652
Target Start/End: Original strand, 13632087 - 13632217
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| |||||||||| || ||||||||||||||||||||||||||||| |||||||||||| |||||| ||||| ||||||||| |
|
|
| T |
13632087 |
tatccagaagtcctagctcaactggcaaaaa-tgtcgaaattgttaggccggatgccatgaccgaggttcgaaccccagtacctccacttgtgtgtgtga |
13632185 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
13632186 |
gtttataatggctttgccatttcgtctatcta |
13632217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 99; E-Value: 2e-48
Query Start/End: Original strand, 525 - 654
Target Start/End: Original strand, 37050703 - 37050830
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||| ||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||| || || ||||||||||||||||||| |
|
|
| T |
37050703 |
cagaagtcttagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccgatagctccacttatgtgtgtgagttt |
37050800 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37050801 |
ataatggctttgccatttcgtctatctacc |
37050830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 99; E-Value: 2e-48
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 47462166 - 47462035
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||| ||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
47462166 |
tatctagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
47462069 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||| |
|
|
| T |
47462068 |
gtttataatgactttgtcatttcgtctatctacc |
47462035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 98; E-Value: 8e-48
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 36526270 - 36526140
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| || ||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
36526270 |
atccagaagtcctagctcaactagcaaaaa--gccgaaattgttaggccggatgccatgattggggttcgaaccccggtacctccacttgtgtgtgtgag |
36526173 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
36526172 |
tttataatggctttgccatttcgtctatctacc |
36526140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 98; E-Value: 8e-48
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 42856562 - 42856692
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| ||||||||||| ||||||||| ||||| |||||||||| |
|
|
| T |
42856562 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgatcggggttcgaattccggtacctccacttgtgtgtgtgag |
42856659 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42856660 |
tttataatggctttgccatttcgtctatctacc |
42856692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 97; E-Value: 3e-47
Query Start/End: Original strand, 527 - 654
Target Start/End: Original strand, 37166142 - 37166267
Alignment:
| Q |
527 |
gaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttat |
626 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||||| ||||| |||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
37166142 |
gaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttat |
37166239 |
T |
 |
| Q |
627 |
aatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
37166240 |
aatggctttgccatttcgtctatctacc |
37166267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 96; E-Value: 1e-46
Query Start/End: Original strand, 522 - 652
Target Start/End: Original strand, 24550812 - 24550940
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||| ||||||| ||||||||| ||||||||||||||||||||||| ||||| |||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
24550812 |
atccagaagtcttagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgtgag |
24550909 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
24550910 |
tttataatggctttgccatttcgtctatcta |
24550940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 96; E-Value: 1e-46
Query Start/End: Original strand, 520 - 654
Target Start/End: Original strand, 29428052 - 29428184
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
||||||||||||||||||||| ||||||||| | ||||||||||||||||||||| ||||| |||||||||||||||||||||| ||||| |||| ||| |
|
|
| T |
29428052 |
gtatccagaagtcctagctcaactggcaaaata--ccgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccacttgtgtgagtg |
29428149 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
29428150 |
agtttataatggctttgccatttcgtctatctacc |
29428184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 96; E-Value: 1e-46
Query Start/End: Original strand, 522 - 652
Target Start/End: Original strand, 34684202 - 34684329
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||| ||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
34684202 |
atccagaagtc-tagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
34684298 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
34684299 |
tttataatggctttgccatttcgtctatcta |
34684329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 42154267 - 42154136
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
42154267 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
42154170 |
T |
 |
| Q |
622 |
-tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
42154169 |
ttttataatggctttaccatttcgtctatctacc |
42154136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 14285094 - 14285224
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||| ||||| |||| |||||||||||||||||||||||||||| |||||||||||||||||| ||||| |||||||||| |
|
|
| T |
14285094 |
atccagaagtcctagctcaactgacaaaa--tgccaaaattgttaggccggatgccatgaccggcgttcgaaccccggtacctccacttgtgtgtgtgag |
14285191 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
14285192 |
tttataatggctttgccatttcatctatctacc |
14285224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 526 - 654
Target Start/End: Original strand, 18813373 - 18813499
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
|||||||||| |||| ||||||||| ||||||||||||||||||||||| |||||||||| ||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
18813373 |
agaagtcctaactcaactggcaaaa--tgccgaaattgttaggccggatgtcatgaccgggcttcgaaccccggtacctccacttgtgtgtgtgagttta |
18813470 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18813471 |
taatggctttgccatttcgtctatctacc |
18813499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 525 - 654
Target Start/End: Original strand, 35828276 - 35828405
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcact--tatgtgtgtgagt |
622 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | ||||||||| | |
|
|
| T |
35828276 |
cagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgtgaat |
35828373 |
T |
 |
| Q |
623 |
ttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35828374 |
ttataatggctttgccatttcgtctatctacc |
35828405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 521 - 653
Target Start/End: Complemental strand, 50779921 - 50779791
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| ||| ||||| ||||||||| |
|
|
| T |
50779921 |
tatccagaagtcttagttcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccgggattcgaaccccggttcctccacttgtgtgtgtga |
50779824 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
50779823 |
gtttataatggctttgccatttcgtctatctac |
50779791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 93; E-Value: 8e-45
Query Start/End: Original strand, 522 - 653
Target Start/End: Complemental strand, 23974771 - 23974642
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||||| ||||||||| |||||||||| ||||||| ||||| |||||||||| |
|
|
| T |
23974771 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatatcatgaccggtgttcgaaccctggtacctccacttgtgtgtgtgag |
23974674 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
23974673 |
tttataatggctttgccatttcgtctatctac |
23974642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 93; E-Value: 8e-45
Query Start/End: Original strand, 549 - 653
Target Start/End: Complemental strand, 25586431 - 25586327
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
25586431 |
aaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttatgtgtgtgagtttataatggctttgtcatttcgtcta |
25586332 |
T |
 |
| Q |
649 |
tctac |
653 |
Q |
| |
|
||||| |
|
|
| T |
25586331 |
tctac |
25586327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 92; E-Value: 3e-44
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 3848948 - 3848816
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| ||| ||||| ||||||| | |
|
|
| T |
3848948 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgctaggccggatgccatgaccggggttcgaaccccggtgcctccacttgtgtgtgtaa |
3848851 |
T |
 |
| Q |
621 |
g-tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3848850 |
gttttataatggctttgccatttcgtctatctacc |
3848816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 6487870 - 6487975
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6487870 |
aaaatgccgaaattgttaggccggatgtcgtgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtcta |
6487969 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
6487970 |
tctacc |
6487975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 88; E-Value: 7e-42
Query Start/End: Original strand, 549 - 652
Target Start/End: Complemental strand, 579346 - 579243
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
579346 |
aaaatgtcgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccacttatgtgtgtgagtttataatggctttgccatttcgtcta |
579247 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
579246 |
tcta |
579243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 88; E-Value: 7e-42
Query Start/End: Original strand, 528 - 654
Target Start/End: Original strand, 28033197 - 28033321
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttata |
627 |
Q |
| |
|
||||||||||||| |||| |||| ||||||||||||||||||||||||||||||||||||||||||||| ||| || ||||| |||||||||||||||| |
|
|
| T |
28033197 |
aagtcctagctcaactggtaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccagtatctccacttgtgtgtgtgagtttata |
28033294 |
T |
 |
| Q |
628 |
atggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||| ||||||||||||||||||||||| |
|
|
| T |
28033295 |
atgactttgccatttcgtctatctacc |
28033321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 49319729 - 49319860
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| || ||||| || ||||||||||||||||||||||||||||||||||||||||| ||||||| | ||| ||||||||| |
|
|
| T |
49319729 |
tatccagaagtcctagctcaactaacaaaa--tgtcgaaattgttaggccggatgccatgaccggggttcgaaccctggtacctccgcttgtgtgtgtga |
49319826 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
49319827 |
gtttataatggcgttgccatttcgtctatctacc |
49319860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 553 - 654
Target Start/End: Complemental strand, 7944324 - 7944223
Alignment:
| Q |
553 |
tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7944324 |
tgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcatctatcta |
7944225 |
T |
 |
| Q |
653 |
cc |
654 |
Q |
| |
|
|| |
|
|
| T |
7944224 |
cc |
7944223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 28010180 - 28010050
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||| |||||||||||| |||| ||||||||||||||||||||||||| || ||||| |||||||||| |
|
|
| T |
28010180 |
atccagaagtcctagctcaactggcaaaa--tgccaaaattgttaggcaggatatcatgaccggggttcgaaccccggtaactccacttgtgtgtgtgag |
28010083 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
28010082 |
tttataatggctttgccatttcatctatctacc |
28010050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 29894409 - 29894539
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| || ||||||| ||||| |||||| |||||||||||||||||||| ||||||| ||||| |||||||||| |
|
|
| T |
29894409 |
atccagaagtcctagctcaactggcaaaa--tgtcgaaattattaggtcggatgtcatgaccggggttcgaaccctggtacctccacttgtgtgtgtgag |
29894506 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
29894507 |
tttataatagctttgccatttcgtctatctacc |
29894539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 35318539 - 35318669
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
|||||||||||||| |||| ||||||||| |||||||||||||||||||||| ||||||||||||||||| || ||||||||||||| || ||||||| |
|
|
| T |
35318539 |
atccagaagtcctaactcaactggcaaaa--tgccgaaattgttaggccggatatcatgaccggggttcgaatcctggtaccttcacttgtgcgtgtgag |
35318636 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
35318637 |
tttataatggttttgccatttcgtctatctacc |
35318669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 526 - 654
Target Start/End: Complemental strand, 54908017 - 54907891
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| || |||| |||||||||||| |||| |||||||||| |||||| |
|
|
| T |
54908017 |
agaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgatcgaggtttgaaccccggtacattcatttatgtgtgtaagttta |
54907920 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||| |||||||| |
|
|
| T |
54907919 |
taatggctttgccatttcgtatatctacc |
54907891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 528 - 654
Target Start/End: Original strand, 24407502 - 24407626
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttata |
627 |
Q |
| |
|
||||||||||||| ||||||||| || ||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
24407502 |
aagtcctagctcaactggcaaaa--tgtcgaaattgttaggtcggatgccatgaccgggattcgaaccccggtaccttcacttgtgtgtgtgaatttata |
24407599 |
T |
 |
| Q |
628 |
atggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||| || ||||||||||||||||| |
|
|
| T |
24407600 |
atggctctgtcatttcgtctatctacc |
24407626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 46552949 - 46553052
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
46552949 |
aaaatgccaaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttatgtgtgtgaatttataatggttttgccatttcgtcta |
46553048 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
46553049 |
tcta |
46553052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 520 - 654
Target Start/End: Original strand, 49535882 - 49536014
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |||||| |||| ||||||| |
|
|
| T |
49535882 |
gtatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgatcggggttcgaaccccagtacctctacttgtgtgtgtc |
49535979 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| |
|
|
| T |
49535980 |
agtttataatggctttgttatttggtctatctacc |
49536014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 28983730 - 28983861
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||||| |||||||| ||||||||| || ||| ||||||||| ||||||||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
28983730 |
tatccagaagttctagctcaactggcaaaa--tgtcgacattgttaggtcggatgccatgaccggggttcgaactccggtacctccacttatgtgtgtga |
28983827 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||| ||||| ||||| ||||||||||| |
|
|
| T |
28983828 |
gtttataatgactttgtcattttgtctatctacc |
28983861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 525 - 654
Target Start/End: Complemental strand, 33416706 - 33416579
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| ||||||||| | ||||||||||||| ||||||| ||||| | |||||||||||| ||||||| ||||| ||||||||||||| |
|
|
| T |
33416706 |
cagaagtcctagctcaactggcaaaata--ccgaaattgttagaccggatgtcatgatcagggttcgaaccctggtacctccacttgtgtgtgtgagttt |
33416609 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33416608 |
ataatggctttgccatttcgtctatctacc |
33416579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 548 - 654
Target Start/End: Complemental strand, 36860954 - 36860848
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| || ||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
36860954 |
aaaaatgccgatattgttaggccggatgtcataactggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtct |
36860855 |
T |
 |
| Q |
648 |
atctacc |
654 |
Q |
| |
|
||||||| |
|
|
| T |
36860854 |
atctacc |
36860848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 521 - 653
Target Start/End: Original strand, 1982559 - 1982689
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||||| ||| |||||||||||||| ||||| |||| | ||||| ||||||||| |
|
|
| T |
1982559 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccgtatgtcatgaccggggttcaaaccctggtaaatccacttgtgtgtgtga |
1982656 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
1982657 |
gtttataatggctttgccattttgtctatctac |
1982689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 12316059 - 12315929
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||| ||||||||| ||| |||||||| |||||| |||||||| |||||||||||| |||||||||||||| ||||| ||||| |||||||||| |
|
|
| T |
12316059 |
atccagaagccctagctcaactg--aaaaaatgtcgaaatagttaggccagatgccatgaccagggttcgaaccccgatacctccacttgtgtgtgtgag |
12315962 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
12315961 |
tttataatggctttgccatttcatctatctacc |
12315929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 554 - 654
Target Start/End: Original strand, 21378317 - 21378415
Alignment:
| Q |
554 |
gccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21378317 |
gccgaaattgttaggccggatgccatgaccggggttcgaactccggtacctccactta--tgtgtgagtttataatggctttgccatttcgtctatctac |
21378414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 531 - 654
Target Start/End: Complemental strand, 39284694 - 39284574
Alignment:
| Q |
531 |
tcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatg |
630 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
39284694 |
tcctagctcaactggcaaa---tgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataata |
39284598 |
T |
 |
| Q |
631 |
gctttgccatttcgtctatctacc |
654 |
Q |
| |
|
| |||| ||||||||||||||||| |
|
|
| T |
39284597 |
gttttgtcatttcgtctatctacc |
39284574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 521 - 652
Target Start/End: Original strand, 1083506 - 1083635
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| |||||||||||||||| | |||| ||||| |||||||||||||||| ||||| ||||| ||||||| | |
|
|
| T |
1083506 |
tatccagaagtcctagttcaactggcaaaa--tgccgaaattgttaggtcagatgtcatgatcggggttcgaaccccgatacctccacttgtgtgtgtaa |
1083603 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1083604 |
gtttataatggctttgccatttcgtctatcta |
1083635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 549 - 653
Target Start/End: Complemental strand, 32104114 - 32104010
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||| |||| | ||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32104114 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaatcccagtacttccacttgtgtgtgtgagtttataatggctttgccatttcatcta |
32104015 |
T |
 |
| Q |
649 |
tctac |
653 |
Q |
| |
|
||||| |
|
|
| T |
32104014 |
tctac |
32104010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 81; E-Value: 1e-37
Query Start/End: Original strand, 521 - 652
Target Start/End: Complemental strand, 39997903 - 39997774
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||| |||| |||||||||| ||| | |||||| ||||||||||||||||||| |||||||||||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
39997903 |
tatctagaactcctagctcaactg--ataaaatgtcgaaattgttaggccggataccatgaccggggttcgaacctcggtacctccacttgtgtgtgtga |
39997806 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |
|
|
| T |
39997805 |
gtttataatgactttgccatttcgtctatcta |
39997774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 526 - 652
Target Start/End: Original strand, 18371349 - 18371473
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
|||||| |||||||| ||||||||| ||||||||||||||||||| || |||||| |||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
18371349 |
agaagttctagctcaactggcaaaa--tgccgaaattgttaggccgaatatcatgactggggtttgaaccccggtacctccacttatgtgtgtgagttta |
18371446 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||| ||||||||||||||| |
|
|
| T |
18371447 |
taatggctttgtcatttcgtctatcta |
18371473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 549 - 654
Target Start/End: Complemental strand, 34660895 - 34660789
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag-tttataatggctttgccatttcgtct |
647 |
Q |
| |
|
|||||||| ||||||||||| |||||| |||||||||||||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
34660895 |
aaaatgcctaaattgttaggtcggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttttataatggctttgccatttcgtct |
34660796 |
T |
 |
| Q |
648 |
atctacc |
654 |
Q |
| |
|
||||||| |
|
|
| T |
34660795 |
atctacc |
34660789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 36752357 - 36752488
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||||||||| |||| ||| ||||| |||||||||||||||||| |||| ||||| |||||||||||||||| ||||| ||||||| | ||||| |
|
|
| T |
36752357 |
tatccagaagtcctaactcaactgacaaaa--tgccgaaattgttaggccagatgtcatgatcggggttcgaaccccgatacctccacttatatatgtga |
36752454 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
36752455 |
gtttataatggctttgtcatttcgtctatctacc |
36752488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 78; E-Value: 7e-36
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 29648763 - 29648893
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| || |||||| ||||||| ||||||||||||||| ||||||| |||||||||||| ||||||| ||||| |||||||||| |
|
|
| T |
29648763 |
atccagaagtcctagctcaactagcaaaa--tgccgaatttgttaggccggatgtcatgaccagggttcgaaccctggtacctccacttgtgtgtgtgag |
29648860 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
29648861 |
tttatgatgactttgccattttgtctatctacc |
29648893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 522 - 652
Target Start/End: Original strand, 31375112 - 31375240
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
|||||||||||||| |||| ||| ||||| || ||||||| ||||||| ||||||||||||||||||||||||||||||||| ||||| ||||||| || |
|
|
| T |
31375112 |
atccagaagtcctaactcaactgccaaaa--tgtcgaaattattaggccagatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtaag |
31375209 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||| ||||| ||||||||||||||| |
|
|
| T |
31375210 |
tttataatgactttgtcatttcgtctatcta |
31375240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 522 - 651
Target Start/End: Complemental strand, 3084371 - 3084244
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||| |||||||||||| ||||||||||| |||| ||||| ||||| |||||||||| |
|
|
| T |
3084371 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggtcggatgccatgatcggggttcgaatcccgatacctccacttgtgtgtgtgag |
3084274 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatct |
651 |
Q |
| |
|
|||||||| |||||| |||| |||||||| |
|
|
| T |
3084273 |
tttataataactttgctattttgtctatct |
3084244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 11371190 - 11371059
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||| ||||||| ||| |||| || ||||||||||||||||||| ||| ||||||| ||||||||||||||||||||| ||||| | ||||||| |
|
|
| T |
11371190 |
tatccagacgtcctagttcaactgg--aataatgccgaaattgttaggctagataccatgacaggggttcgaaccccggtacctccacttgtatgtgtga |
11371093 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
11371092 |
gtttataatgactttgccatttcgtctatctacc |
11371059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 522 - 652
Target Start/End: Original strand, 17480930 - 17481059
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| |||| |||||||| ||| |||||| |||| |||||||||||||| ||||||||| | |||||||||||||||||| | ||||||||| |||||| |
|
|
| T |
17480930 |
atccacaagttctagctcaactgacaaaaa-tgccaaaattgttaggccgaatgccatgatcagggttcgaaccccggtacttccacttatgtatgtgag |
17481028 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |
|
|
| T |
17481029 |
tttataatggctttgtcatttcgtctatcta |
17481059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 51675797 - 51675666
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||| ||||||||||||| || ||||| || | ||||||||||||||||| |||||||||||||||||| ||||||||| ||||| ||||||||| |
|
|
| T |
51675797 |
tatccataagtcctagctcaactaacaaaatat--ctaaattgttaggccggatatcatgaccggggttcgaactccggtacctccacttgtgtgtgtga |
51675700 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
51675699 |
gtttataatggctttgtcatttcgtctatctacc |
51675666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 525 - 653
Target Start/End: Complemental strand, 52556509 - 52556384
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
||||| |||||||||| ||||||||| |||| |||||||||||||||||||||||| |||||||||||||||| | ||| ||||| ||||||||| ||| |
|
|
| T |
52556509 |
cagaaatcctagctcaactggcaaaa--tgccaaaattgttaggccggatgccatgatcggggttcgaaccccgat-cctccacttgtgtgtgtgaattt |
52556413 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||||||| |||||||||| |
|
|
| T |
52556412 |
ataatggctttgccattttgtctatctac |
52556384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 73; E-Value: 7e-33
Query Start/End: Original strand, 522 - 649
Target Start/End: Original strand, 3037236 - 3037361
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
|||||||| |||||||||| ||| ||||| |||||||||| |||||| ||||| |||||||||||||||||| |||| |||| |||||||||||||||| |
|
|
| T |
3037236 |
atccagaaatcctagctcaactgtcaaaa--tgccgaaattattaggctggatgtcatgaccggggttcgaactccggcacctccacttatgtgtgtgag |
3037333 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
|||||||||| |||| |||||||||||| |
|
|
| T |
3037334 |
tttataatggttttgtcatttcgtctat |
3037361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 73; E-Value: 7e-33
Query Start/End: Original strand, 522 - 652
Target Start/End: Original strand, 4379306 - 4379432
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||| ||| ||| ||||| ||||||||||||||||||||||||||||||||| ||||||| |||| ||| | ||| |||||||||| |
|
|
| T |
4379306 |
atccagaagtcctagttcaactgacaaaa--tgccgaaattgttaggccggatgccatgaccggagttcgaatcccgatacatcaact--tgtgtgtgag |
4379401 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4379402 |
tttataatggctttgccatttcgtctatcta |
4379432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 73; E-Value: 7e-33
Query Start/End: Original strand, 570 - 654
Target Start/End: Complemental strand, 16477020 - 16476936
Alignment:
| Q |
570 |
cggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16477020 |
cggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtctatctacc |
16476936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 73; E-Value: 7e-33
Query Start/End: Original strand, 549 - 653
Target Start/End: Original strand, 17271323 - 17271427
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||| |||||||||||||| |||||||||||||||||||||||||||||||| ||||| ||| |
|
|
| T |
17271323 |
aaaatgccgaaattgttaggccaaatgccatgactggggtttgaaccccggtacctccacttatgtgtgtgagtttataatggctttgcaatttcaccta |
17271422 |
T |
 |
| Q |
649 |
tctac |
653 |
Q |
| |
|
||||| |
|
|
| T |
17271423 |
tctac |
17271427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 73; E-Value: 7e-33
Query Start/End: Original strand, 521 - 652
Target Start/End: Complemental strand, 31436048 - 31435919
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||| ||||||||| ||| |||| |||| ||||||||||||||||||||||| ||||| ||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
31436048 |
tatccacaagtcctagttcaactggtaaaa--tgccgaaattgttaggccggatgtcatgattggggttcgaaccccggtacctccacttgtgtgtgtga |
31435951 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||| |||| |||| |||||||||| |
|
|
| T |
31435950 |
gtttataatggttttgtcattccgtctatcta |
31435919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 552 - 654
Target Start/End: Original strand, 7413119 - 7413221
Alignment:
| Q |
552 |
atgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatct |
651 |
Q |
| |
|
||||||| |||||||| ||||||||||| ||||||||||||| |||||||||| ||||||| ||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
7413119 |
atgccgatattgttagaccggatgccataaccggggttcgaatcccggtacctccacttatatgtgtgagtttataatgactttgtcatttcgtctatct |
7413218 |
T |
 |
| Q |
652 |
acc |
654 |
Q |
| |
|
||| |
|
|
| T |
7413219 |
acc |
7413221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 552 - 654
Target Start/End: Original strand, 7459199 - 7459301
Alignment:
| Q |
552 |
atgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatct |
651 |
Q |
| |
|
||||||| |||||||| ||||||||||| ||||||||||||| |||||||||| ||||||| ||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
7459199 |
atgccgatattgttagaccggatgccataaccggggttcgaatcccggtacctccacttatatgtgtgagtttataatgactttgtcatttcgtctatct |
7459298 |
T |
 |
| Q |
652 |
acc |
654 |
Q |
| |
|
||| |
|
|
| T |
7459299 |
acc |
7459301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 549 - 654
Target Start/End: Complemental strand, 1052987 - 1052882
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||||||| ||||||| ||||| | |||||||||||||||||||||| |||||| |||| |
|
|
| T |
1052987 |
aaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaaccctggtacctccacttgtatgtgtgagtttataatggctttatcatttcatcta |
1052888 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
1052887 |
tctacc |
1052882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 577 - 654
Target Start/End: Complemental strand, 5333282 - 5333205
Alignment:
| Q |
577 |
catgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5333282 |
catgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtctatctacc |
5333205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 528 - 652
Target Start/End: Complemental strand, 48628587 - 48628465
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttata |
627 |
Q |
| |
|
||||||||||||| |||| ||| |||| |||||||||| |||||||||||| |||||||||||||||||| ||||| || |||||||||||||||| |
|
|
| T |
48628587 |
aagtcctagctcaactggtaaag--tgccaaaattgttagattggatgccatgactggggttcgaaccccggtatcttcatttgtgtgtgtgagtttata |
48628490 |
T |
 |
| Q |
628 |
atggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
48628489 |
atggctttgccatttcgtctatcta |
48628465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 525 - 653
Target Start/End: Complemental strand, 8810896 - 8810769
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||| ||||||||||| ||| |||||| |||||||||| ||||| |||||| ||||||||| |||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
8810896 |
cagatgtcctagctcaactgacaaaaa-tgccgaaattattaggtcggatgtcatgaccggagttcgaaccccggtacctcaacttgtgtgtgtgagttt |
8810798 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||| ||||| ||||||||||||||| |
|
|
| T |
8810797 |
ataatgactttgttatttcgtctatctac |
8810769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 526 - 654
Target Start/End: Complemental strand, 28187289 - 28187159
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtg----tgtgag |
621 |
Q |
| |
|
||||||||||||||| ||| | |||||| ||||||||||||||||||||| |||| |||||||||||| || |||||| |||||||||| |||||| |
|
|
| T |
28187289 |
agaagtcctagctcaactg--ataaaatgtcgaaattgttaggccggatgctatgatcggggttcgaactccagtacctccacttatgtgtgtgtgtgag |
28187192 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
28187191 |
tttataatgactttgccatttcgtctatctacc |
28187159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 549 - 653
Target Start/End: Original strand, 36608025 - 36608128
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| |||||||||||| | ||| ||||||| |||||||||||| ||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
36608025 |
aaaatgtcgaaattgttag-ctggacgccatgatcggggttcgaactccggtaccttcacttatgtatgggagtttataatggctttgccatttcgtcta |
36608123 |
T |
 |
| Q |
649 |
tctac |
653 |
Q |
| |
|
||||| |
|
|
| T |
36608124 |
tctac |
36608128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 528 - 654
Target Start/End: Original strand, 24870601 - 24870727
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttat |
626 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||| | ||||||| |||||||||| |||||||| ||| ||| |||||||||||||| |
|
|
| T |
24870601 |
aagtcctagctcaactggcaaaa-atgccgaaattgttaggccggacgtaatgaccgaggttcgaacctcggtacctccactttacgtgtgtgagtttat |
24870699 |
T |
 |
| Q |
627 |
aatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||| |||| |||||||| |
|
|
| T |
24870700 |
gatggctttgccatctcgtttatctacc |
24870727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 549 - 652
Target Start/End: Complemental strand, 31583706 - 31583604
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| ||||||||| ||||| |||| |||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31583706 |
aaaatgtcgaaattgt-aggcccgatgttatgattggggttcgaaccccggtacctccacttatgtgtgtgagtttataatggctttgccatttcgtcta |
31583608 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
31583607 |
tcta |
31583604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 531 - 654
Target Start/End: Complemental strand, 51564511 - 51564386
Alignment:
| Q |
531 |
tcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagt----ttat |
626 |
Q |
| |
|
|||||||||| ||||||||| |||||||| |||||||||||| ||||||||| ||||||||||||||| |||| |||||||| |||||||| |||| |
|
|
| T |
51564511 |
tcctagctcaactggcaaaa--tgccgaaactgttaggccggacgccatgaccagggttcgaaccccggcacctccacttatgcgtgtgagtttatttat |
51564414 |
T |
 |
| Q |
627 |
aatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| |||||||||||||||||| |
|
|
| T |
51564413 |
aatggctttaccatttcgtctatctacc |
51564386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 522 - 652
Target Start/End: Complemental strand, 25699069 - 25698939
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg-- |
619 |
Q |
| |
|
||||||||||||||||||| ||||||| || ||||||| |||||||||||||||||| ||| |||||||| |||||||| ||||| |||||||| |
|
|
| T |
25699069 |
atccagaagtcctagctcaagaggcaaaa--tgtcgaaattattaggccggatgccatgatcggagttcgaacagcggtacctccacttgtgtgtgtgtg |
25698972 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
25698971 |
agtttataatggctttgccatttcgtctatcta |
25698939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 26440965 - 26441096
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||| || |||||||||| ||||||||| |||||||||||||||||||| || ||||||| |||||| ||||| | ||||| ||||| ||||||||| |
|
|
| T |
26440965 |
tatccaaaaatcctagctcaactggcaaaa--tgccgaaattgttaggccgggtgtcatgaccagggttccaaccctgatacctccacttgtgtgtgtga |
26441062 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| |
|
|
| T |
26441063 |
atttataatgactttgcaatttcgtctatctacc |
26441096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 51281490 - 51281595
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcact--tatgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |||| | ||||||||| ||||||||| ||||| ||||||||| |
|
|
| T |
51281490 |
aaaatgccgaaattgttaggccggatgccatgaccggagttcgaaccccgatacctccacttgtgtgtgtgtgaatttataatgactttgtcatttcgtc |
51281589 |
T |
 |
| Q |
647 |
tatcta |
652 |
Q |
| |
|
|||||| |
|
|
| T |
51281590 |
tatcta |
51281595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 526 - 633
Target Start/End: Complemental strand, 1033574 - 1033471
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |||||||||||||| |
|
|
| T |
1033574 |
agaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccctaatacctccact--tgtgtgtgagttta |
1033479 |
T |
 |
| Q |
626 |
taatggct |
633 |
Q |
| |
|
|||||||| |
|
|
| T |
1033478 |
taatggct |
1033471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 35615909 - 35616014
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| ||||||||||||||| |||| ||||||||||||||||| || ||||||| |||||||||||||||||||||||| ||||| |||||| |||| |
|
|
| T |
35615909 |
aaaatgtcgaaattgttaggccagatgtcatgaccggggttcgaatcctggtacctccacttatgtgtgtgagtttataataactttgtcatttcatcta |
35616008 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
35616009 |
tctacc |
35616014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 550 - 654
Target Start/End: Complemental strand, 16971785 - 16971681
Alignment:
| Q |
550 |
aaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||||||| ||||| ||||| |||||||||||||||||| ||||| |||| ||||||| |
|
|
| T |
16971785 |
aaatgcccaaattgttaggccggatgttatgaccggggttcgaaccccgctacctccacttgtgtgtgtgagtttataataactttgtcattccgtctat |
16971686 |
T |
 |
| Q |
650 |
ctacc |
654 |
Q |
| |
|
||||| |
|
|
| T |
16971685 |
ctacc |
16971681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 522 - 649
Target Start/End: Complemental strand, 17518602 - 17518477
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||| ||||||| |||| |||| |||| ||||||||| |||||||||||||| |||||||| ||||| ||||||| || ||||||||||||| |
|
|
| T |
17518602 |
atccagaagtcttagctcaactggtaaaa--tgccaaaattgttacgccggatgccatgatcggggttcaaaccctggtacctccatttatgtgtgtgag |
17518505 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
|||||||| ||||| |||||||||||| |
|
|
| T |
17518504 |
tttataataactttgtcatttcgtctat |
17518477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 520 - 652
Target Start/End: Original strand, 32233608 - 32233739
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
|||| |||||||||||| ||| || |||||| ||||||||||||||| ||||||| |||| |||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
32233608 |
gtattcagaagtcctagttcaactcgcaaaa-atgccgaaattgttatgccggatattatgaatggggtttgaaccccggtacctccacttgtgtgtgtg |
32233706 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| |
|
|
| T |
32233707 |
agtttataatgactttgtcatttcgtctatcta |
32233739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 558 - 652
Target Start/End: Complemental strand, 42550518 - 42550423
Alignment:
| Q |
558 |
aaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| ||| |||||| ||| |||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42550518 |
aaattgttaggccggatgccatgaccgggattcgaatcccagtacctccactttatatgtgtaagtttataatggctttgccatttcgtctatcta |
42550423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 518 - 654
Target Start/End: Complemental strand, 9064922 - 9064787
Alignment:
| Q |
518 |
tagtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggta-ccttcacttatgtgt |
616 |
Q |
| |
|
||||||||| ||||||||||||| || | |||| ||| |||||||||||| || ||||||| | ||||||||||||||||||| ||| ||||| ||||| |
|
|
| T |
9064922 |
tagtatccacaagtcctagctcaactagtaaaa--tgctgaaattgttaggtcgaatgccataatcggggttcgaaccccggtaccctccacttgtgtgt |
9064825 |
T |
 |
| Q |
617 |
gtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||| ||||| ||||| ||||||||||| |
|
|
| T |
9064824 |
gtgagtttataatgactttgtcattttgtctatctacc |
9064787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 522 - 652
Target Start/End: Complemental strand, 9747395 - 9747266
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||| ||| || | ||||| || ||||||||||| | | |||||||||| ||||||||||||| | ||||| ||||| | |||||||| |
|
|
| T |
9747395 |
atccagaagtcctagatcaactcgtaaaaa-tgtcgaaattgttatgtcagatgccatgatcggggttcgaaccttgatacctccacttgtatgtgtgag |
9747297 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9747296 |
tttataatggctttgccatttcgtctatcta |
9747266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 525 - 654
Target Start/End: Original strand, 54864398 - 54864525
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||| ||| || |||||| || | ||||||||||| |||||||||||| ||||||| ||||| |||||||| |||| ||||||||||||| |
|
|
| T |
54864398 |
cagaagtcctagatcaactagcaaaa--tgtcaaaattgttaggtcggatgccatgatcggggtttgaacctcggtacctcaacttgtgtgtgtgagttt |
54864495 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||| ||||| ||||||||||||||||| |
|
|
| T |
54864496 |
ataatgactttgtcatttcgtctatctacc |
54864525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 528 - 636
Target Start/End: Original strand, 11673298 - 11673403
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttata |
627 |
Q |
| |
|
||||||||||||| ||||||||| | ||||||||||||||| ||||||||||| ||||||||||||||| |||||| ||||||||||||| |||||||| |
|
|
| T |
11673298 |
aagtcctagctcaactggcaaaata--ccgaaattgttaggcaggatgccatgatcggggttcgaacccc-gtacctccacttatgtgtgtaagtttata |
11673394 |
T |
 |
| Q |
628 |
atggctttg |
636 |
Q |
| |
|
||| ||||| |
|
|
| T |
11673395 |
atgactttg |
11673403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 549 - 642
Target Start/End: Original strand, 29334519 - 29334612
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccattt |
642 |
Q |
| |
|
||||| |||||||||||||| |||||| ||||||||| |||| ||||||||||||| || || ||||||||||||||||||||||||||||||| |
|
|
| T |
29334519 |
aaaataccgaaattgttaggtcggatgtcatgaccggagttcaaaccccggtacctccatttgtgtgtgtgagtttataatggctttgccattt |
29334612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 52772140 - 52772245
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||| ||||||||||| |||||||| ||| ||||||||||| |||| ||||||||||| ||||||| |||||||| || ||||| ||||||||||| |
|
|
| T |
52772140 |
aaaatgccaaaattgttaggtcggatgccttgatcggggttcgaatcccgataccttcacttgtgtgtgtaagtttatattgactttgtcatttcgtcta |
52772239 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
52772240 |
tctacc |
52772245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 549 - 654
Target Start/End: Complemental strand, 54097044 - 54096939
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||| |||| |||||| |||||||| |||||||||||||||||| ||||| ||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
54097044 |
aaaatgccgaaattattagatcggatgtcatgaccgacgttcgaaccccggtacctccacttgtgtgtgtgagtttataatgactttgtcatttcgtctg |
54096945 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
54096944 |
tctacc |
54096939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 61; E-Value: 1e-25
Query Start/End: Original strand, 525 - 652
Target Start/End: Complemental strand, 9038332 - 9038208
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
||||||| |||||||| || |||||| ||||||||||||| | ||||||| ||||||||| ||| ||| |||||||||| ||||| ||||||||||||| |
|
|
| T |
9038332 |
cagaagttctagctcaactagcaaaa--tgccgaaattgtttgaccggatgtcatgaccggagtttgaatcccggtacctccacttgtgtgtgtgagttt |
9038235 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||| ||||| |||||||||||||| |
|
|
| T |
9038234 |
ataatgg-tttgcaatttcgtctatcta |
9038208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 61; E-Value: 1e-25
Query Start/End: Original strand, 548 - 652
Target Start/End: Original strand, 13218220 - 13218324
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||| | ||||||||||| |||||||||||| ||||||||||||||| |||| | ||||| | ||||||||||||||||| ||||||||||||||| |
|
|
| T |
13218220 |
aaaaatgtcaaaattgttaggtcggatgccatgatcggggttcgaaccccagtacttccacttgtatgtgtgagtttataatgattttgccatttcgtct |
13218319 |
T |
 |
| Q |
648 |
atcta |
652 |
Q |
| |
|
||||| |
|
|
| T |
13218320 |
atcta |
13218324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 61; E-Value: 1e-25
Query Start/End: Original strand, 528 - 651
Target Start/End: Complemental strand, 17846873 - 17846752
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttata |
627 |
Q |
| |
|
|||| |||||||| ||||||||| || |||||||||||||| |||| | |||| || |||||||||| |||||||| ||||| ||||||||||||| || |
|
|
| T |
17846873 |
aagttctagctcaactggcaaaa--tgtcgaaattgttaggctggatcctatgatcgaggttcgaacctcggtacctccacttgtgtgtgtgagtttcta |
17846776 |
T |
 |
| Q |
628 |
atggctttgccatttcgtctatct |
651 |
Q |
| |
|
||| |||||||||||||||||||| |
|
|
| T |
17846775 |
atgactttgccatttcgtctatct |
17846752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 61; E-Value: 1e-25
Query Start/End: Original strand, 549 - 653
Target Start/End: Complemental strand, 54420265 - 54420161
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||||| ||||||||| | ||| || ||||||||| ||||||| |||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
54420265 |
aaaatgccgaaattgttatgccggatgctaggactggagttcgaaccatggtacctctacttatgtgtgtaagtttataatagctttgccatttcgtcta |
54420166 |
T |
 |
| Q |
649 |
tctac |
653 |
Q |
| |
|
||||| |
|
|
| T |
54420165 |
tctac |
54420161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 3780338 - 3780441
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||||||||| || | |||||| | ||||||||| ||||||||| ||||| | ||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
3780338 |
aaaatgccgaaattgttaggccagacgtcatgactgaggttcgaactccggtacctccacttgtatgtgtaagtttataatggctttgtcatttcgtcta |
3780437 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
3780438 |
tcta |
3780441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 41323558 - 41323661
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| |||||||||||| ||||||| |||| ||||||||||||||||||||||||||| |||||||||||||||||| |||| || ||||||||| |
|
|
| T |
41323558 |
aaaatgtcgaaattgttagatcggatgctatgattggggttcgaaccccggtaccttcacttctgtgtgtgagtttataataactttaccgtttcgtcta |
41323657 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
41323658 |
tcta |
41323661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 523 - 654
Target Start/End: Complemental strand, 17815270 - 17815142
Alignment:
| Q |
523 |
tccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagt |
622 |
Q |
| |
|
|||| ||||||||| ||| ||||||||| |||||||||||||||| || | | |||||| | | |||||||||| |||||| || || ||||||||||| |
|
|
| T |
17815270 |
tccacaagtcctagttcaactggcaaaa--tgccgaaattgttaggtcgaacgtcatgactgag-ttcgaaccccagtacctccatttgtgtgtgtgagt |
17815174 |
T |
 |
| Q |
623 |
ttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |
|
|
| T |
17815173 |
ttataatggctttgccatttcgactatctacc |
17815142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 522 - 649
Target Start/End: Original strand, 42116480 - 42116604
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||| ||||||||| |||| |||| || ||||||| ||||| |||||||||||| ||||||||||||||||||| || ||||| |||||||||| |
|
|
| T |
42116480 |
atccagaagccctagctcaactggtaaaa--tgtcgaaatttttaggtcggatgccatgatcggggttcgaaccccggta-ctccacttgtgtgtgtgag |
42116576 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
|||| |||| ||||| |||||| ||||| |
|
|
| T |
42116577 |
tttacaatgactttgtcatttcatctat |
42116604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 591 - 654
Target Start/End: Original strand, 25003798 - 25003861
Alignment:
| Q |
591 |
gaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25003798 |
gaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtctatctacc |
25003861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 45725162 - 45725264
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || |||||||||| ||||||||| |||| ||||||||||||||||||| |||| | ||||||| || |
|
|
| T |
45725162 |
aaaatgccgaaattgttaggc-ggatgtcatgatcgaggttcgaacctcggtacctttacttgtgtgtgtgagtttataatgactttactatttcgtgta |
45725260 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
45725261 |
tcta |
45725264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 55214500 - 55214605
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt-ataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||| |||||| |||||||||| ||||| ||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
55214500 |
aaaatgctaaaattgttaggtcggatgccatgaccgaa-ttcgaatcccggtacctccacttgtgtgtgtgagttttataatggctttgcaatttcgtct |
55214598 |
T |
 |
| Q |
648 |
atctacc |
654 |
Q |
| |
|
||||||| |
|
|
| T |
55214599 |
atctacc |
55214605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 521 - 652
Target Start/End: Complemental strand, 5060540 - 5060413
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||||||||| |||| ||| | |||||| |||||||||||| |||||| ||||| ||| |||||||||||| |||||||||||||| ||||| |
|
|
| T |
5060540 |
tatccagaagtcctaactcaactg--ataaaatgtcgaaattgttagtccggatatcatgatcggcgttcgaaccccgataccttcacttatg--tgtga |
5060445 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||| ||||| |||||| |||||||| |
|
|
| T |
5060444 |
gtttataataactttgtcatttcatctatcta |
5060413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 522 - 652
Target Start/End: Complemental strand, 9749212 - 9749087
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||| ||| ||| ||||| |||||||||||||| |||||||||||||| |||| ||||||||| | ||||| || ||||||||| |
|
|
| T |
9749212 |
atccagaagtcctagttcaattggtaaaaa-tgccgaaattgttatgccggatgccatgatcgggattcgaaccctgatacct----ctacgtgtgtgag |
9749118 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| |
|
|
| T |
9749117 |
tttataatggttttgtcatttcgtctatcta |
9749087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 54086010 - 54086140
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| ||||||||||||| ||| ||||| | |||||||||||| | ||||| |||||| ||||||||||||||| ||||| ||||||| ||| |||| |
|
|
| T |
54086010 |
atccaaaagtcctagctcaactgacaaaata--ccgaaattgttaagtcggataccatgatcggggttcgaaccccaatacctccacttatatgtatgag |
54086107 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| |||| |||||| |||||||||| |
|
|
| T |
54086108 |
tttataatgattttgtcatttcatctatctacc |
54086140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 525 - 652
Target Start/End: Original strand, 4901924 - 4902048
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
||||||||||||||| ||| | |||||| | ||||||||||||||||||| |||||||||| ||||| || |||| || || |||||||||| ||||| |
|
|
| T |
4901924 |
cagaagtcctagctcgactg--ataaaatgtcaaaattgttaggccggatgctatgaccggggctcgaatcctggtatctcca-ttatgtgtgtaagttt |
4902020 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||| ||| |||||||||||||||| |
|
|
| T |
4902021 |
ataatggttttcccatttcgtctatcta |
4902048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 549 - 653
Target Start/End: Original strand, 17358070 - 17358174
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||| ||||||||||| ||||||| ||||| ||||||||||||||| ||| || ||||| |||||||||||||||||| ||| | |||||||||| |
|
|
| T |
17358070 |
aaaatgctgaaattgttagaccggatgtcatgatcggggttcgaaccccagtatctccacttgtgtgtgtgagtttataataaatttactatttcgtcta |
17358169 |
T |
 |
| Q |
649 |
tctac |
653 |
Q |
| |
|
||||| |
|
|
| T |
17358170 |
tctac |
17358174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 549 - 653
Target Start/End: Original strand, 25726619 - 25726723
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| |||||||||||||| | ||||||||| |||||||||||| |||||| ||||| ||||||||||||||| ||| ||||||| ||||||||| |
|
|
| T |
25726619 |
aaaatgacgaaattgttaggcagaatgccatgatcggggttcgaacttaagtacctccacttgtgtgtgtgagtttatgatgactttgccgtttcgtcta |
25726718 |
T |
 |
| Q |
649 |
tctac |
653 |
Q |
| |
|
||||| |
|
|
| T |
25726719 |
tctac |
25726723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 531 - 654
Target Start/End: Original strand, 28758384 - 28758507
Alignment:
| Q |
531 |
tcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttataat |
629 |
Q |
| |
|
|||||| ||| ||||||||| ||||||||||| ||||| |||| | ||||||||| ||||||||||| |||||| ||| || |||||||||||||||||| |
|
|
| T |
28758384 |
tcctagttcaactggcaaaa-atgccgaaattattaggtcggacgtcatgaccggagttcgaaccccagtacctccactttgtgtgtgtgagtttataat |
28758482 |
T |
 |
| Q |
630 |
ggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
| |||||| || || |||||||||| |
|
|
| T |
28758483 |
gactttgcaatctcttctatctacc |
28758507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 531 - 654
Target Start/End: Original strand, 38882724 - 38882841
Alignment:
| Q |
531 |
tcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatg |
630 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||| ||| | ||||||||| |||||||||||||||||| ||| | ||||||||| ||| |
|
|
| T |
38882724 |
tcctagctcaactggcaaaaaatgtcgaaattgttaggctggacgtcatgaccggagttcgaaccccggtacctccac------gaatgagtttatgatg |
38882817 |
T |
 |
| Q |
631 |
gctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||| ||| ||||||||| |
|
|
| T |
38882818 |
gctttgccatctcgcctatctacc |
38882841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 521 - 653
Target Start/End: Original strand, 2573927 - 2574057
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaatt-gttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
|||| ||||||||||||||| | || |||| || ||||||| |||||| |||||| ||||| |||| ||||||| ||||||| | ||||| ||| |||| |
|
|
| T |
2573927 |
tatctagaagtcctagctcaacaggtaaaa--tgtcgaaatttgttaggtcggatgtcatgatcgggattcgaactccggtacatccacttgtgtatgtg |
2574024 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
2574025 |
agtt-ataatggctttgccatttcgtctatctac |
2574057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 525 - 610
Target Start/End: Complemental strand, 5880412 - 5880329
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcactt |
610 |
Q |
| |
|
||||||||||| |||| ||||||||| || |||||||||||| |||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
5880412 |
cagaagtcctaactcaactggcaaaa--tgtcgaaattgttagaccggatgccatgaccggggttcgaaccccgatacctccactt |
5880329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 572 - 654
Target Start/End: Original strand, 37913352 - 37913436
Alignment:
| Q |
572 |
gatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgt--gagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||| ||||||||||||| ||||||||||||||||| | |||| ||||||||||| |
|
|
| T |
37913352 |
gatgtcatgatcggggttcgaaccccggtacctccacttatgtgtgtgagagtttataatggctttactattttgtctatctacc |
37913436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 548 - 625
Target Start/End: Original strand, 38814606 - 38814683
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||| || |||||||| |||||||||||||||||||||||||||| ||||| ||||| |||||||||||||| |
|
|
| T |
38814606 |
aaaaatgccaaatttgttaggttggatgccatgaccggggttcgaaccccgatacctccacttgtgtgtgtgagttta |
38814683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 528 - 654
Target Start/End: Original strand, 46194254 - 46194377
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag-tttat |
626 |
Q |
| |
|
||||||||||||| ||||||||| || | ||||||||||| |||||| ||||| | |||||||||| |||||| || |||| |||||||||| ||||| |
|
|
| T |
46194254 |
aagtcctagctcaactggcaaaa--tgtcaaaattgttaggtcggatgtcatgatcagggttcgaactccggtaactccact--tgtgtgtgagttttat |
46194349 |
T |
 |
| Q |
627 |
aatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||| ||||| ||||||||||||||||| |
|
|
| T |
46194350 |
aatgactttgtcatttcgtctatctacc |
46194377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 528 - 652
Target Start/End: Original strand, 46343333 - 46343457
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttca-cttatgtgtgtgagtttat |
626 |
Q |
| |
|
||||||||||||| ||| ||||| ||||||||||||||||||||| | |||||||||||||||||||| |||||| || ||| |||||||||||||| |
|
|
| T |
46343333 |
aagtcctagctcaactgacaaaag-tgccgaaattgttaggccggacgtcatgaccggggttcgaaccctagtacctccattttacgtgtgtgagtttat |
46343431 |
T |
 |
| Q |
627 |
aatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||| ||||| ||| || |||||||| |
|
|
| T |
46343432 |
gatgactttgtcatctcttctatcta |
46343457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 583 - 651
Target Start/End: Original strand, 939645 - 939713
Alignment:
| Q |
583 |
cggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatct |
651 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
939645 |
cggggttcgaaccacggtacctccacttatgtgtgtgagtttataataactttgtcatttcgtctatct |
939713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 557 - 649
Target Start/End: Original strand, 8017882 - 8017974
Alignment:
| Q |
557 |
gaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||| ||| ||||| ||||| |||||||||||||| |||| |||| |||||| |||||| |
|
|
| T |
8017882 |
gaaattgttaggccggatgttatgaccggggttagaactccgatacctccacttttgtgtgtgagtttaaaatgactttaccattttgtctat |
8017974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 521 - 604
Target Start/End: Original strand, 12694521 - 12694602
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacct |
604 |
Q |
| |
|
|||||||||||||||||||| ||| ||||| ||| |||| |||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
12694521 |
tatccagaagtcctagctcaactgacaaaa--tgctgaaactgttaggccggatgccatgaccggggttcgaatcccgatacct |
12694602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 521 - 620
Target Start/End: Complemental strand, 39301400 - 39301303
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||| ||| |||||||| ||||||| |||||||||||||| ||||||| |||||||||||| ||||||| ||||| ||||||||| |
|
|
| T |
39301400 |
tatccagaagtcctagttcaactggcaaac--tgccgaatttgttaggccggatatcatgaccagggttcgaaccctggtacctccacttgtgtgtgtga |
39301303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 572 - 652
Target Start/End: Original strand, 40996413 - 40996493
Alignment:
| Q |
572 |
gatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||| |||| ||||||||||||||||| |||| || |||||| |||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
40996413 |
gatgctatgatcggggttcgaaccccggcacctccatttatgtatgtgagtttataatggttttgccattttgtctatcta |
40996493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 522 - 653
Target Start/End: Original strand, 44171648 - 44171779
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtg--tg |
619 |
Q |
| |
|
||||||||||||||||||| || |||||| |||| ||||| ||| |||||||| ||||||||||| |||||||||| ||| | ||||| |||||| || |
|
|
| T |
44171648 |
atccagaagtcctagctcaactagcaaaa--tgccaaaattattaagccggatgacatgaccgggggtcgaaccccgatacttccacttgtgtgtgtatg |
44171745 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||| ||||| ||||| | |||||||| |
|
|
| T |
44171746 |
agtttataataactttgtcattttgactatctac |
44171779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 522 - 653
Target Start/End: Complemental strand, 55853444 - 55853327
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||| ||||||||||| ||||||||||||| || ||||| |||||||||||||||| |
|
|
| T |
55853444 |
atccagaagtcctagctcaactggcaaaaa-tgccaaaattgttaggttggatgccatgacc-------------cgatacctccacttatgtgtgtgag |
55853359 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||| || |||||||||||||| |
|
|
| T |
55853358 |
tttataatggctttaccgtttcgtctatctac |
55853327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 558 - 652
Target Start/End: Complemental strand, 2942530 - 2942436
Alignment:
| Q |
558 |
aaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||| |||||||||||| |||| ||||||||||| ||||| ||||| | |||||||||||| ||| |||||||||||| | |||||| |
|
|
| T |
2942530 |
aaattgttaggtcggatgccatgatcgggattcgaaccccgatacctccacttgcgcgtgtgagtttatgatgactttgccatttcatttatcta |
2942436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 547 - 653
Target Start/End: Original strand, 43588788 - 43588893
Alignment:
| Q |
547 |
aaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||| |||| ||||||||||| || |||||||| ||||||||| |||| |||| |||| ||||||| |
|
|
| T |
43588788 |
aaaaaatgcggaaattgttaggccggatgtcatgatcggg-ttcgaaccccgatatcttcacttgtgtgtgtgaatttaaaatgactttatcatttcgat |
43588886 |
T |
 |
| Q |
647 |
tatctac |
653 |
Q |
| |
|
||||||| |
|
|
| T |
43588887 |
tatctac |
43588893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 549 - 653
Target Start/End: Complemental strand, 6328955 - 6328851
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||| ||||||||||| | || | | || |||||||||||||||| | || | |||||||||||||||||||||||| |||||||||||| ||| |
|
|
| T |
6328955 |
aaaatgccaaaattgttaggtcagacgtctcgatcggggttcgaaccccgacatctccgcttatgtgtgtgagtttataatggttttgccatttcgccta |
6328856 |
T |
 |
| Q |
649 |
tctac |
653 |
Q |
| |
|
||||| |
|
|
| T |
6328855 |
tctac |
6328851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 548 - 616
Target Start/End: Complemental strand, 11311631 - 11311564
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgt |
616 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||||||||||| ||||||||| ||||| ||||| |
|
|
| T |
11311631 |
aaaaatgccgaaattgttaggccggatgtcatga-cggggttcgaactccggtacctccacttgtgtgt |
11311564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 600 - 652
Target Start/End: Original strand, 34567102 - 34567154
Alignment:
| Q |
600 |
taccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34567102 |
tacctccacttgtgtgtgtgagtttataatggctttgccatttcgtctatcta |
34567154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 521 - 652
Target Start/End: Original strand, 50501403 - 50501531
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||| | |||||||| ||||||||| | | |||||||||| |||||||| |||| ||| ||||| | ||||||||| || |||| ||||||| |
|
|
| T |
50501403 |
tatccagaaattctagctcaactggcaaaata--ctgaaattgttaagccggatgttatgattgggattcga-ctccggtacctccatttatatgtgtga |
50501499 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||| ||| |||||||||||||||| |
|
|
| T |
50501500 |
gtttataatggttttaccatttcgtctatcta |
50501531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 522 - 653
Target Start/End: Complemental strand, 10758016 - 10757887
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgt--gtg |
619 |
Q |
| |
|
|||||||||||||| |||| ||| ||||| |||||||||||||||| |||||||||||| ||| ||| ||| |||||||||| ||||| ||||| ||| |
|
|
| T |
10758016 |
atccagaagtcctacctcaactgccaaaa--tgccgaaattgttaggtcggatgccatga-cggagtttgaa-cccggtacctccacttgtgtgtgagtg |
10757921 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||| ||| | ||||| ||||||||| |
|
|
| T |
10757920 |
agtttataatgaattttcaatttcatctatctac |
10757887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 522 - 653
Target Start/End: Complemental strand, 10971187 - 10971058
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgt--gtg |
619 |
Q |
| |
|
|||||||||||||| |||| ||| ||||| |||||||||||||||| |||||||||||| ||| ||| ||| |||||||||| ||||| ||||| ||| |
|
|
| T |
10971187 |
atccagaagtcctacctcaactgccaaaa--tgccgaaattgttaggtcggatgccatga-cggagtttgaa-cccggtacctccacttgtgtgtgagtg |
10971092 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||| ||| | ||||| ||||||||| |
|
|
| T |
10971091 |
agtttataatgaattttcaatttcatctatctac |
10971058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 549 - 652
Target Start/End: Complemental strand, 11310279 - 11310177
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| ||| ||||||| | |||||| ||||| | |||| | |||||| ||||| |||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
11310279 |
aaaatgtcgatattgttaagtcggatgtcatgatcaaggtttgcaccccg-tacctccacttatgtgtgtgagtttataatggctttacaatttcgtcta |
11310181 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
11310180 |
tcta |
11310177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 547 - 622
Target Start/End: Complemental strand, 19392242 - 19392167
Alignment:
| Q |
547 |
aaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagt |
622 |
Q |
| |
|
||||||||||||||||| ||||||||| || ||||||||||||||||||||| ||| ||||| ||||||||||| |
|
|
| T |
19392242 |
aaaaaatgccgaaattgctaggccggacaccgtgaccggggttcgaaccccggctcctccacttgtgtgtgtgagt |
19392167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 548 - 639
Target Start/End: Complemental strand, 35463911 - 35463821
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgcca |
639 |
Q |
| |
|
||||||||| ||||||||||| ||||| |||||| | ||||||||||||||||||| ||||| ||||||||||||||| |||||||||| |
|
|
| T |
35463911 |
aaaaatgccaaaattgttaggttggatgtcatgactgtggttcgaaccccggtacctccactt-tgtgtgtgagtttatggaggctttgcca |
35463821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 548 - 646
Target Start/End: Complemental strand, 35352195 - 35352097
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
||||||| ||||||||||||| ||||| |||| |||||| |||||||||||||| |||| ||||| ||||||||||||| ||||| ||||||||| |
|
|
| T |
35352195 |
aaaaatgtcgaaattgttaggtcggatattatgatgggggtttgaaccccggtacctctacttgtgtgtctgagtttataatgtctttgtcatttcgtc |
35352097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 549 - 630
Target Start/End: Original strand, 43002564 - 43002643
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatg |
630 |
Q |
| |
|
||||||||||||||| |||||| ||| ||||| ||||||||||||| || |||||||||| ||||||||||||||||||| |
|
|
| T |
43002564 |
aaaatgccgaaattgctaggccatatgtcatgatcggggttcgaacctcgataccttcact--tgtgtgtgagtttataatg |
43002643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 549 - 630
Target Start/End: Complemental strand, 52303200 - 52303121
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatg |
630 |
Q |
| |
|
||||||| ||||||||||||| |||||| |||| ||||||||||| |||||||||| |||| ||| ||||||||||||||| |
|
|
| T |
52303200 |
aaaatgctgaaattgttaggctggatgctatgatcggggttcgaatcccggtacctccact--tgtatgtgagtttataatg |
52303121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 584 - 653
Target Start/End: Complemental strand, 33583685 - 33583616
Alignment:
| Q |
584 |
ggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||| | |||| ||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33583685 |
ggggttcgaaccatgacacctccacttgtgtgtgtgagtttataacggctttgccatttcgtctatctac |
33583616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 523 - 654
Target Start/End: Original strand, 33840619 - 33840748
Alignment:
| Q |
523 |
tccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagt |
622 |
Q |
| |
|
|||| ||||||||||||| || |||||| ||||||||||| |||||||||| ||||| | |||||||||||||||| ||| |||| | ||||||||| |
|
|
| T |
33840619 |
tccacaagtcctagctcaactagcaaaa-atgccgaaattattaggccggacgccataatcggggttcgaaccccgactcctccact--tttgtgtgagt |
33840715 |
T |
 |
| Q |
623 |
ttataatggct-ttgccatttcgtctatctacc |
654 |
Q |
| |
|
|| ||||| | |||||||||| |||||||||| |
|
|
| T |
33840716 |
ttcgaatggttgttgccatttcatctatctacc |
33840748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 522 - 613
Target Start/End: Original strand, 21172878 - 21172967
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatg |
613 |
Q |
| |
|
||||||||||||| ||||| |||| |||| |||||||||||||| ||||||| |||| |||||||||||||||||||||||| ||||| |
|
|
| T |
21172878 |
atccagaagtcctggctcaactggtaaaa--tgccgaaattgttaaaccggatgttatgattggggttcgaaccccggtaccttcagttatg |
21172967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 558 - 637
Target Start/End: Original strand, 16460969 - 16461047
Alignment:
| Q |
558 |
aaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgc |
637 |
Q |
| |
|
||||||||||| |||| | ||||| |||| ||||||||||| |||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
16460969 |
aaattgttaggtcggacgtcatgatcggg-ttcgaaccccgacaccttcacttgtgtgtgtgagtttataagggctttgc |
16461047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 522 - 605
Target Start/End: Complemental strand, 35273436 - 35273354
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctt |
605 |
Q |
| |
|
||||| ||||||||||||| |||||||||| || |||||||||||||||| ||||||||| ||| ||| ||| ||||| ||||| |
|
|
| T |
35273436 |
atccacaagtcctagctcaactggcaaaaa-tgtcgaaattgttaggccgtatgccatgatcggagtttgaatcccggcacctt |
35273354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 528 - 653
Target Start/End: Original strand, 37759432 - 37759558
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccgggg-ttcgaaccccggtaccttcactta-tgtgtgtgagttta |
625 |
Q |
| |
|
||||| ||||||| |||||||||| ||| ||||||||||| ||||| | ||||| ||||| |||||||| || | ||| ||||| |||||||||||||| |
|
|
| T |
37759432 |
aagtcatagctcaactggcaaaaa-tgctgaaattgttagaccggacgtcatgatcgggggttcgaacctcgattcctccactttgtgtgtgtgagttta |
37759530 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
| ||||||||| ||| || ||||||||| |
|
|
| T |
37759531 |
tgatggctttgtcatctcttctatctac |
37759558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 521 - 651
Target Start/End: Complemental strand, 53398418 - 53398290
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||| |||| ||||||| ||||||||| || ||||||||||||| | ||| ||||||||| |||||||| | | ||| ||||||| ||||||| | |
|
|
| T |
53398418 |
tatccacaagttttagctcaactggcaaaa--tgttgaaattgttaggctgaatgtcatgaccggagttcgaactcggatactttcacttgtgtgtgtaa |
53398321 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatct |
651 |
Q |
| |
|
|| ||||||| |||| |||||||||||||| |
|
|
| T |
53398320 |
gtatataatgactttttcatttcgtctatct |
53398290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 597 - 654
Target Start/End: Complemental strand, 3802987 - 3802929
Alignment:
| Q |
597 |
cggtaccttcacttatgtgtgtgagtttataatggc-tttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
3802987 |
cggtacctccacttgtgtgtgtgagtttataatgacttttgccatttcgtctatctacc |
3802929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 523 - 616
Target Start/End: Complemental strand, 4432020 - 4431928
Alignment:
| Q |
523 |
tccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgt |
616 |
Q |
| |
|
|||| ||||||||||||| |||||||||| || | ||||| |||| |||| || |||||||||||||||||| | |||||| ||||||||||| |
|
|
| T |
4432020 |
tccacaagtcctagctcaactggcaaaaa-tgtcaaaattattagatcggacgctatgaccggggttcgaacctcagtacctccacttatgtgt |
4431928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 522 - 630
Target Start/End: Complemental strand, 12619312 - 12619206
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
|||||||||||||| |||| ||| ||||| | |||||||| ||| |||||||| || || | ||||||||||||| ||||| ||||||| | |||||| |
|
|
| T |
12619312 |
atccagaagtcctaactcaactgacaaaata--ccgaaattattaagccggatgtcaagatcagggttcgaaccccaatacctccacttatatatgtgag |
12619215 |
T |
 |
| Q |
622 |
tttataatg |
630 |
Q |
| |
|
||||||||| |
|
|
| T |
12619214 |
tttataatg |
12619206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 525 - 652
Target Start/End: Original strand, 51425332 - 51425454
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||| ||| || |||||| ||||||||||||||||||||||| ||||| | ||||| ||||| ||| | || || |||||||||||| |
|
|
| T |
51425332 |
cagaagtcctagttcaactagcaaaa--tgccgaaattgttaggccggatgtcatgaacagggtttgaaccaaa-tacatccattt--gtgtgtgagttt |
51425426 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||| ||||| ||||||||||||||| |
|
|
| T |
51425427 |
ataatgactttgtcatttcgtctatcta |
51425454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 578 - 652
Target Start/End: Original strand, 21172965 - 21173038
Alignment:
| Q |
578 |
atgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgcca-tttcgtctatcta |
652 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||| ||||||||| |||||||||| ||| ||| ||||||||||||| |
|
|
| T |
21172965 |
atgatcggggttcgaaccccagtaccttcact--tgtgtgtgaatttataatggtttttccattttcgtctatcta |
21173038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 585 - 653
Target Start/End: Original strand, 34123468 - 34123536
Alignment:
| Q |
585 |
gggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||| ||||| ||||||| |||||||| || |||||||||||||||||| |||||||||||||||| |
|
|
| T |
34123468 |
gggtttgaaccatggtacctctacttatgtatgagagtttataatggctttgtcatttcgtctatctac |
34123536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 549 - 601
Target Start/End: Original strand, 47384222 - 47384274
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggta |
601 |
Q |
| |
|
|||||| || ||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
47384222 |
aaaatgtcggaattgttaggccggatgtcatgaccagggttcgaaccccggta |
47384274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 548 - 652
Target Start/End: Original strand, 48860027 - 48860129
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||| || |||||||||||| || ||||||||| ||| ||||||| | ||||| |||| ||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
48860027 |
aaaaatgtcgtaattgttaggccaaataccatgaccgaggt-cgaaccc-gatacctcaacttgtgtatgtgagtttataatgactttgtcatttcgtct |
48860124 |
T |
 |
| Q |
648 |
atcta |
652 |
Q |
| |
|
||||| |
|
|
| T |
48860125 |
atcta |
48860129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 528 - 654
Target Start/End: Original strand, 13849360 - 13849486
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttat |
626 |
Q |
| |
|
||||||||||||| ||| |||||| || ||||||||||||| | || | | ||| |||||||||||||||| |||| ||| || |||||| |||||| | |
|
|
| T |
13849360 |
aagtcctagctcaactgacaaaaa-tgtcgaaattgttaggtcagacgtcttgatcggggttcgaaccccgacacctccactttgtgtgtgggagtttgt |
13849458 |
T |
 |
| Q |
627 |
aatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||| |||||||||||| ||||| |||| |
|
|
| T |
13849459 |
tatgactttgccatttcttctatgtacc |
13849486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 549 - 652
Target Start/End: Complemental strand, 31010049 - 31009946
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||||||||||||||||| ||| ||||| | || ||||||| | ||||||| |||||| | ||| |||||||||| |||||| |||||| |||| |
|
|
| T |
31010049 |
aaaatgccgaaattgttaggctaaatgtcatgatcaggtttcgaactcaggtacctccacttaaatatgtaagtttataatagctttgtcatttcatcta |
31009950 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
31009949 |
tcta |
31009946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 549 - 653
Target Start/End: Complemental strand, 44619962 - 44619856
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatg--tgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
|||||| |||||| |||||| |||||| ||||| ||||| |||||||| ||||| || || | ||||||| |||||||| |||||||||||||||| |
|
|
| T |
44619962 |
aaaatgtcgaaatagttaggtcggatgttatgactagggtttgaaccccgatacctccatttgttgttgtgtgaatttataatagctttgccatttcgtc |
44619863 |
T |
 |
| Q |
647 |
tatctac |
653 |
Q |
| |
|
||||||| |
|
|
| T |
44619862 |
tatctac |
44619856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 550 - 644
Target Start/End: Original strand, 23766085 - 23766179
Alignment:
| Q |
550 |
aaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcg |
644 |
Q |
| |
|
||||||| ||||| ||||||| || | ||||||||| ||| ||| ||| |||| ||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
23766085 |
aaatgccaaaattattaggccagacgtcatgaccggagtttgaattccgacacctccacttgagtgtgtgagtttataatgcctttgccatttcg |
23766179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 547 - 629
Target Start/End: Original strand, 30922501 - 30922583
Alignment:
| Q |
547 |
aaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataat |
629 |
Q |
| |
|
|||||||| ||||||||||| |||| ||| ||||| || |||||||||||| ||||| ||||| ||||||| | |||||||| |
|
|
| T |
30922501 |
aaaaaatgtcgaaattgttatgccgaatgtcatgataggagttcgaaccccgatacctccacttgtgtgtgtaaatttataat |
30922583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 528 - 653
Target Start/End: Complemental strand, 32057847 - 32057723
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcactta-tgtgtgtgagtttat |
626 |
Q |
| |
|
||||||||||||| ||||||||| || | ||||||||||| |||| |||||| | | ||||||||| ||||||| ||||| ||||||||||||||| |
|
|
| T |
32057847 |
aagtcctagctcaactggcaaaat-tgtcaaaattgttaggtcggacatcatgactgtgattcgaaccc-ggtacctccactttgtgtgtgtgagtttat |
32057750 |
T |
 |
| Q |
627 |
aatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||| |||| ||| |||||||||||| |
|
|
| T |
32057749 |
gatggttttgtcatctcgtctatctac |
32057723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 523 - 588
Target Start/End: Complemental strand, 21156084 - 21156020
Alignment:
| Q |
523 |
tccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggt |
588 |
Q |
| |
|
|||| ||||||||||||| |||||||||| ||||||||||| ||||| ||| ||| |||||||||| |
|
|
| T |
21156084 |
tccacaagtcctagctcaactggcaaaaa-tgccgaaattgctaggctggacgccgtgaccggggt |
21156020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 614 - 654
Target Start/End: Original strand, 26872200 - 26872241
Alignment:
| Q |
614 |
tgtgtgagttt-ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26872200 |
tgtgtgagttttataatggctttgccatttcgtctatctacc |
26872241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 587 - 652
Target Start/End: Complemental strand, 27009414 - 27009349
Alignment:
| Q |
587 |
gttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||| || || ||||||||| ||||||||||||||| ||||| |||||| | |||||| |
|
|
| T |
27009414 |
gttcgaaccccgatatctccacttatgtatgtgagtttataatgactttgtcatttcatttatcta |
27009349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 551 - 628
Target Start/End: Complemental strand, 38173472 - 38173395
Alignment:
| Q |
551 |
aatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataa |
628 |
Q |
| |
|
|||||||||||||||||| |||||| ||| || ||||||| |||||| ||| ||||| ||||||||||||||||| |
|
|
| T |
38173472 |
aatgccgaaattgttaggtcggatgttgtgattggagttcgaatcccggtgcctccacttgtgtgtgtgagtttataa |
38173395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 549 - 626
Target Start/End: Complemental strand, 40610726 - 40610650
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttat |
626 |
Q |
| |
|
|||||| |||||||||||||| ||| | ||||| ||| ||||||||| ||||||||||| || ||||||| ||||||| |
|
|
| T |
40610726 |
aaaatgtcgaaattgttaggctggacgtcatgatcggagttcgaacctcggtaccttca-ttttgtgtgttagtttat |
40610650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 556 - 649
Target Start/End: Original strand, 41049072 - 41049165
Alignment:
| Q |
556 |
cgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
|||||||||||||||| | | ||||| || | |||||| |||| |||||||||||| | ||| ||||||||||| ||||| ||||| |||||| |
|
|
| T |
41049072 |
cgaaattgttaggccgaacgtcatgatcgagattcgaatcccgacaccttcacttatctatgtaagtttataatgactttgtcattttgtctat |
41049165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 526 - 596
Target Start/End: Original strand, 1173955 - 1174022
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
596 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| |||||||| | ||||||| |||||||||||| |
|
|
| T |
1173955 |
agaagtcctagctcaactggcaaa---tgccgaaattgcaaggccggacgtcatgacctgggttcgaaccc |
1174022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 526 - 596
Target Start/End: Original strand, 34739284 - 34739351
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
596 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| |||||||| | ||||||| |||||||||||| |
|
|
| T |
34739284 |
agaagtcctagctcaactggcaaa---tgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
34739351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 584 - 652
Target Start/End: Original strand, 43446762 - 43446830
Alignment:
| Q |
584 |
ggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||| |||| ||||| ||||||| | || |||||||||||| |||||| ||||||| |||||| |
|
|
| T |
43446762 |
ggggttcgaatcccgatacctccacttatatatgcgagtttataatgactttgctatttcgtttatcta |
43446830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 556 - 652
Target Start/End: Original strand, 47248927 - 47249023
Alignment:
| Q |
556 |
cgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||| ||| | | ||||| |||||||||||| | |||| |||||||| || |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
47248927 |
cgaaattgttagaccgcacgttatgacgggggttcgaacctcaacacctccacttatgcgtaagagtttataatgactttgacatttcgtctatcta |
47249023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 550 - 629
Target Start/End: Complemental strand, 47920810 - 47920730
Alignment:
| Q |
550 |
aaatgccgaaattgttaggccggatgccatgaccggggttcgaacccc-ggtaccttcacttatgtgtgtgagtttataat |
629 |
Q |
| |
|
|||||| |||||||||| ||| || ||| | |||||||||||| || |||||| ||||||||||||||||||||||||| |
|
|
| T |
47920810 |
aaatgctgaaattgttaaaccgattgtcataatcggggttcgaactcctggtaccctcacttatgtgtgtgagtttataat |
47920730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 526 - 596
Target Start/End: Complemental strand, 54768556 - 54768489
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
596 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| |||||||| | ||||||| |||||||||||| |
|
|
| T |
54768556 |
agaagtcctagctcaactggcaaa---tgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
54768489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 548 - 626
Target Start/End: Complemental strand, 9696397 - 9696318
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttat |
626 |
Q |
| |
|
||||||| ||||||||||||| || | | |||| ||||||||||||| |||||||| ||| |||||||||| ||||||| |
|
|
| T |
9696397 |
aaaaatgtcgaaattgttaggtcgaacgttatgatcggggttcgaacctcggtacctccactttatgtgtgtaagtttat |
9696318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 584 - 650
Target Start/End: Original strand, 15540082 - 15540148
Alignment:
| Q |
584 |
ggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatc |
650 |
Q |
| |
|
||||||||||| ||| |||| || |||||| |||||||||||||| |||||| |||||| |||||| |
|
|
| T |
15540082 |
ggggttcgaacttcggcacctccatttatgtatgtgagtttataatagctttgtcatttcatctatc |
15540148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 577 - 643
Target Start/End: Complemental strand, 27031890 - 27031824
Alignment:
| Q |
577 |
catgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttc |
643 |
Q |
| |
|
|||||||| ||||||||| ||| |||||||||| |||||| ||||||||||| ||||| |||||| |
|
|
| T |
27031890 |
catgaccgtggttcgaactccgacaccttcacttgggtgtgtaagtttataatgactttgtcatttc |
27031824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 548 - 653
Target Start/End: Complemental strand, 51579073 - 51578967
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcactt-atgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
|||||||||||||||||||| |||| | |||| || ||| |||| ||| ||||| ||||| || | ||||||||||| ||||||||||||| || || |
|
|
| T |
51579073 |
aaaaatgccgaaattgttagatcggacgttatgattggagtttgaactccgatacctccactttatctatgtgagtttatgatggctttgccatgtcttc |
51578974 |
T |
 |
| Q |
647 |
tatctac |
653 |
Q |
| |
|
||||||| |
|
|
| T |
51578973 |
tatctac |
51578967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 548 - 652
Target Start/End: Complemental strand, 37340212 - 37340108
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcactta-tgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
||||||| |||||||||||||||| | | ||||| | || |||||||| ||||| || ||||| ||||||||||||||| ||| |||| ||| ||||| |
|
|
| T |
37340212 |
aaaaatgtcgaaattgttaggccgaacgtcatgatcagg-ttcgaaccacggtatctccactttgtgtgtgtgagtttatgatgattttgtcatctcgtc |
37340114 |
T |
 |
| Q |
647 |
tatcta |
652 |
Q |
| |
|
|||||| |
|
|
| T |
37340113 |
tatcta |
37340108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 107; Significance: 3e-53; HSPs: 150)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 3e-53
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 35476620 - 35476489
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
35476620 |
tatccagaagtcctagctcaactggcaaaa--tgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
35476523 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
35476522 |
gtttataatggctttgccatttcgtctatctacc |
35476489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 106; E-Value: 1e-52
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 20251614 - 20251484
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
20251614 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgag |
20251517 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
20251516 |
tttataatggctttgccatttcgtctatctacc |
20251484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 106; E-Value: 1e-52
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 36754870 - 36754740
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
36754870 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgctatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
36754773 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
36754772 |
tttataatggctttgccatttcgtctatctacc |
36754740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 104; E-Value: 2e-51
Query Start/End: Original strand, 523 - 653
Target Start/End: Original strand, 39070019 - 39070147
Alignment:
| Q |
523 |
tccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagt |
622 |
Q |
| |
|
|||||||||||||||||| |||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
39070019 |
tccagaagtcctagctcaactggtaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagt |
39070116 |
T |
 |
| Q |
623 |
ttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
39070117 |
ttataatggctttgccatttcgtctatctac |
39070147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 103; E-Value: 8e-51
Query Start/End: Original strand, 520 - 653
Target Start/End: Complemental strand, 13268106 - 13267975
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||| |||||| |||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
13268106 |
gtatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
13268009 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
13268008 |
agtttataatggctttgccatttcgtctatctac |
13267975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 103; E-Value: 8e-51
Query Start/End: Original strand, 525 - 654
Target Start/End: Complemental strand, 34481797 - 34481670
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
34481797 |
cagaagtcctagctcaactggcaaaa--tgccgaaattgttaggctggatgccatgaccggggttcgaaccccggtaccctcacttgtgtgtgtgagttt |
34481700 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34481699 |
ataatggctttgccatttcgtctatctacc |
34481670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 102; E-Value: 3e-50
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 12236120 - 12236250
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| |||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
12236120 |
atccagaagtcctagctcaactggtaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgaa |
12236217 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
12236218 |
tttataatggctttgccatttcgtctatctacc |
12236250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 102; E-Value: 3e-50
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 15897213 - 15897343
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
15897213 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
15897310 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
15897311 |
tttataatgcctttgccatttcgtctatctacc |
15897343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 102; E-Value: 3e-50
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 34667043 - 34667173
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||||||||| ||||||||| |||||||||||||||||| ||||| |||||||||| |
|
|
| T |
34667043 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgaccggagttcgaaccccggtacctccacttgtgtgtgtgag |
34667140 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34667141 |
tttataatggctttgccatttcgtctatctacc |
34667173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 102; E-Value: 3e-50
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 40812016 - 40812146
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
|||||||||||||| |||| ||| ||||| |||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40812016 |
atccagaagtcctacctcaactgacaaaa--tgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
40812113 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
40812114 |
tttataatggctttgccatttcgtctatctacc |
40812146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 99; E-Value: 2e-48
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 32023251 - 32023382
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |||||||||| |
|
|
| T |
32023251 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcctccacttgtgtgtgtgag |
32023348 |
T |
 |
| Q |
622 |
-tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
32023349 |
ttttataatggctttgccatttcgtctatctacc |
32023382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 99; E-Value: 2e-48
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 33607041 - 33607172
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||||| ||||||||||| ||||||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
33607041 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccagatgccatgactggggttcgaaccccgatacctccacttgtgtgtgtga |
33607138 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
33607139 |
gtttataatggctttgccatttcgtctatctacc |
33607172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 98; E-Value: 8e-48
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 6731541 - 6731671
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| || |||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| | ||||| |||||||||| |
|
|
| T |
6731541 |
atccagaagtcctagctcaactagcaaaa--tgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacatccacttgtgtgtgtgag |
6731638 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6731639 |
tttataatggctttgccatttcgtctatctacc |
6731671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 98; E-Value: 8e-48
Query Start/End: Original strand, 525 - 654
Target Start/End: Complemental strand, 11543926 - 11543798
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||||||| |||||||||||| ||||||| |||||||||||||| ||||| ||||||||||||| |
|
|
| T |
11543926 |
cagaagtcctagctcaactggcaaaaa-tgccgaaattgttaggtcggatgccatgatcggggtttgaaccccggtacctccacttgtgtgtgtgagttt |
11543828 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
11543827 |
ataatggctttgccatttcgtctatctacc |
11543798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 96; E-Value: 1e-46
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 38490530 - 38490398
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
38490530 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgactggggttcgaaccccggtacctccacttgtgtgtgtga |
38490433 |
T |
 |
| Q |
621 |
g-tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
38490432 |
gttttataatgactttgccatttcgtctatctacc |
38490398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 96; E-Value: 1e-46
Query Start/End: Original strand, 520 - 654
Target Start/End: Original strand, 44948016 - 44948148
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
||||||||||||||||||||| ||| ||||| || ||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| | |||||| |
|
|
| T |
44948016 |
gtatccagaagtcctagctcaactgacaaaa--tgtcgaaattgttaggccggatgccatgaccggggttcgaactccggtacctccacttgtatgtgtg |
44948113 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
44948114 |
agtttataatggctttgccatttcgtctatctacc |
44948148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 4014943 - 4014812
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||| ||||||||||||| ||| ||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
4014943 |
tatccacaagtcctagctcaactgacaaaa--tgccgaaattgttaggccggatctcatgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
4014846 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
4014845 |
gtttataatggctttgccatttcgtctatctacc |
4014812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 45049383 - 45049514
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||| ||||||| ||||||||| || |||||||||||||||||||| ||||||||||||||||| |||||||||| ||||| ||||||||| |
|
|
| T |
45049383 |
tatccagaagtcttagctcaactggcaaaa--tgtcgaaattgttaggccggatgtcatgaccggggttcgaatcccggtacctccacttgtgtgtgtga |
45049480 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
45049481 |
gtttataatggctttgccatttcgtctatctacc |
45049514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 93; E-Value: 8e-45
Query Start/End: Original strand, 521 - 652
Target Start/End: Complemental strand, 727419 - 727290
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||| ||||| |||||||||||||||| |||||||||||| |||||||||||| ||||||||| ||||| ||||||||| |
|
|
| T |
727419 |
tatccagaagtcctagctcaactgacaaaa--tgccgaaattgttaggtcggatgccatgatcggggttcgaactccggtacctccacttgtgtgtgtga |
727322 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
727321 |
gtttataatggctttgccatttcgtctatcta |
727290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 91; E-Value: 1e-43
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 23497642 - 23497511
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||| ||| |||| |||| ||||||||||||||||||||||| | |||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
23497642 |
tatccagaagtcctagttcaactggtaaaa--tgccgaaattgttaggccggatgtcgtgaccggggttcgaaccccggtacctccacttgtgtgtgtga |
23497545 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
23497544 |
gtttataatggctttgtcatttcgtctatctacc |
23497511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 91; E-Value: 1e-43
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 23957050 - 23957181
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||||| |||||||| ||||||||| || |||||||||||||||||||| ||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
23957050 |
tatccagaagttctagctcaactggcaaaa--tgtcgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccacttatgtgtgtga |
23957147 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||| |
|
|
| T |
23957148 |
gtttttaatggctttgtcatttcgtctatctacc |
23957181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 91; E-Value: 1e-43
Query Start/End: Original strand, 525 - 654
Target Start/End: Complemental strand, 43461460 - 43461333
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| |||| |||| || ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
43461460 |
cagaagtcctagctcaactggtaaaa--tgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttt |
43461363 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||| ||||| ||||||||||||||||| |
|
|
| T |
43461362 |
ataatgactttgtcatttcgtctatctacc |
43461333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 10392644 - 10392774
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| |||| |||| |||||| |||||||||||||||||||||||||| ||||||||||||||| || ||||| |||||||||| |
|
|
| T |
10392644 |
atccagaagtcctagctcaactggtaaaa--tgccgacattgttaggccggatgccatgaccggagttcgaaccccggtatctccacttgtgtgtgtgag |
10392741 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
10392742 |
tttattatggctttgccatttcgtctatctacc |
10392774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 526 - 654
Target Start/End: Original strand, 24381248 - 24381374
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||||||||| || |||||| || |||||||||||||| |||||||||||||||||||||||||||||||||| | ||| |||||||||||||| |
|
|
| T |
24381248 |
agaagtcctagctcaactagcaaaa--tgtcgaaattgttaggctggatgccatgaccggggttcgaaccccggtacctccgcttgtgtgtgtgagttta |
24381345 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
24381346 |
taatggctttgccatttcgtctatctacc |
24381374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 42414529 - 42414634
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42414529 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacatccacttgtgtgtgtgagtttataatagctttgccatttcgtcta |
42414628 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
42414629 |
tctacc |
42414634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 88; E-Value: 7e-42
Query Start/End: Original strand, 520 - 654
Target Start/End: Original strand, 43035437 - 43035569
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
||||||||||||||||||||| |||||||| | ||||||||||||||||||||| ||||| |||||||||||||||||||||| |||| |||||||| |
|
|
| T |
43035437 |
gtatccagaagtcctagctcaattggcaaaata--ccgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtg |
43035534 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
43035535 |
agtttataatggctttaccatttcgtctatctacc |
43035569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 522 - 642
Target Start/End: Complemental strand, 23080227 - 23080108
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
23080227 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
23080130 |
T |
 |
| Q |
622 |
-tttataatggctttgccattt |
642 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
23080129 |
ttttataatggctttgccattt |
23080108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 3048541 - 3048671
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| ||||||||||||| || |||||| || |||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3048541 |
atccataagtcctagctcaactagcaaaa--tgtcgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttatgtgtgtgag |
3048638 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||| |||||||||| ||||||||||||||||| |
|
|
| T |
3048639 |
tttttaatggctttatcatttcgtctatctacc |
3048671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 86; E-Value: 1e-40
Query Start/End: Original strand, 549 - 654
Target Start/End: Complemental strand, 15920718 - 15920613
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| ||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
15920718 |
aaaatgccgaaattgttaggccggatgtcatgaccggggttcgaacccaggtacctccacttgtgtgtatgagtttataatggctttgccatttcgtcta |
15920619 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
15920618 |
tctacc |
15920613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 85; E-Value: 5e-40
Query Start/End: Original strand, 522 - 645
Target Start/End: Complemental strand, 2287438 - 2287317
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |||||| ||| |
|
|
| T |
2287438 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatatcatgaccggggttcgaaccccggtacctccacttgtgtgtgggag |
2287341 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgt |
645 |
Q |
| |
|
|||||||| ||||||||||||||| |
|
|
| T |
2287340 |
tttataatagctttgccatttcgt |
2287317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 42007345 - 42007209
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-----ttatgtg |
615 |
Q |
| |
|
|||||||||||||||||||| |||| |||| || ||||||||||||||||||||||||||||||||||||||||||||||||| ||| || |||| |
|
|
| T |
42007345 |
tatccagaagtcctagctcaactggtaaaa--tgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgttgtgtg |
42007248 |
T |
 |
| Q |
616 |
tgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42007247 |
tgtgagtttataatggctttgctatttcgtctatctacc |
42007209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 520 - 653
Target Start/End: Complemental strand, 7975145 - 7975014
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
||||||| ||||||||||||| ||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
7975145 |
gtatccacaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgctatgaccggggttcgaaccccggtacctccacttgtgtgtgtg |
7975048 |
T |
 |
| Q |
620 |
agtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
| |||||||| ||||||||||| ||||||||| |
|
|
| T |
7975047 |
aaagtataatggatttgccatttcatctatctac |
7975014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 23458678 - 23458809
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||| |||||||| |||| |||| |||||||| ||||||||||||| |||| ||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
23458678 |
tatccacaagtcctaactcaactgg--aaaaatgctgaaattgttaggctggataccatgaccggggttcgaaccccggtacctccactcgtgtgtgtga |
23458775 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
23458776 |
gtttataatggctttgccattttgtctatctacc |
23458809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 28855544 - 28855413
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||| |||||||||||||| ||||||||| |||| ||||||||||| ||||||||||||| |||||||||| |||||| ||||||||| ||||||||| |
|
|
| T |
28855544 |
tatccggaagtcctagctcaactggcaaaa--tgccaaaattgttagggcggatgccatgactggggttcgaatcccggttccttcacttgtgtgtgtga |
28855447 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
28855446 |
atttataatggctttgccattttgtctatctacc |
28855413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 83; E-Value: 7e-39
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 41164778 - 41164647
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| |||||||| || ||||||||||||||||||| ||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
41164778 |
tatccagaagtcctagctcaactggcaaag--tgtcgaaattgttaggccggatatcatgaccggggttcgaaccccagtacctctacttatgtgtgtga |
41164681 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||| |
|
|
| T |
41164680 |
gtttataatggctttgtcatttcatctatctacc |
41164647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 36794803 - 36794933
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| |||| |||| || | |||||||||||||| ||||||||| ||||||||||||| |||| ||| ||||| |||||||||| |
|
|
| T |
36794803 |
atccagaagtcctagctcaactggtaaaa--tgtcaaaattgttaggccgaatgccatgatcggggttcgaacctcggttcctccacttgtgtgtgtgag |
36794900 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
36794901 |
tttataatggctttgccatttcgtctatctacc |
36794933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 82; E-Value: 3e-38
Query Start/End: Original strand, 549 - 654
Target Start/End: Complemental strand, 37198835 - 37198730
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| ||||||||||||||| |||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
37198835 |
aaaatgtcgaaattgttaggccagatggcatgatcggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgcaatttcatcta |
37198736 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
37198735 |
tctacc |
37198730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 525 - 654
Target Start/End: Original strand, 11061385 - 11061511
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
||||||||||| |||| ||| | |||||| ||||||||||||||||||||| |||||||||||||||||||||| ||||| ||| ||||||||||||| |
|
|
| T |
11061385 |
cagaagtcctaactcaactg--ataaaatgtcgaaattgttaggccggatgc-atgaccggggttcgaaccccggcacctttactagtgtgtgtgagttt |
11061481 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
11061482 |
ataatggctttgccatttcgtctatctacc |
11061511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 42200992 - 42200861
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||| |||||||||||||||||| ||||| ||||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
42200992 |
tatccagaagtcctagctcaactggcaaaa--tgccaaaattgttaggccggatgtcatgatcggggttcgaacctcggtacctccacttgtgtgtgtga |
42200895 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||| ||| ||||||||||||| |||| |
|
|
| T |
42200894 |
gtttataatgatttttccatttcgtctatttacc |
42200861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 77; E-Value: 3e-35
Query Start/End: Original strand, 522 - 653
Target Start/End: Complemental strand, 16010742 - 16010613
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||| ||||||| ||||||||| || ||||||||||| ||||||| | |||| |||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
16010742 |
atccagaagtcgtagctcaactggcaaaa--tgtcgaaattgttaagccggatactatgatcggggttcgaaccccggtacctcaacttgtgtgtgtgag |
16010645 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |
|
|
| T |
16010644 |
tttataatggctttgtcatttcgtctatctac |
16010613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 18368792 - 18368924
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||| ||||||||||||||| ||||||||| |||||||||||||||| ||||| ||||| |||||||||||||||||||||| ||||| ||||| ||| |
|
|
| T |
18368792 |
tatctagaagtcctagctcaactggcaaaa--tgccgaaattgttaggtcggatatcatgatcggggttcgaaccccggtacctccacttgtgtgtctga |
18368889 |
T |
 |
| Q |
621 |
g-tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
18368890 |
gttttataatgactttgccatttcgtctatctacc |
18368924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 549 - 652
Target Start/End: Complemental strand, 37644337 - 37644234
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||||||||||||||| ||||| ||||| ||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
37644337 |
aaaatgtcgaaattgttaggccggatgccatgatcggggttcgaaccccgatacctccacttgtgtgtgtaagtttataatagctttgccatttcgtcta |
37644238 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
37644237 |
tcta |
37644234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 15488747 - 15488878
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||| ||||||||||||||| || | ||||||||||||||||||||||||||| ||||||||| |||||||||| |||||| ||||| ||||||||| |
|
|
| T |
15488747 |
tatctagaagtcctagctcaacta--ataaaatgccgaaattgttaggccggatgtcatgaccggagttcgaaccctggtacccccacttgtgtgtgtga |
15488844 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||| |
|
|
| T |
15488845 |
gtttataatgactttgtcatttcgtctatctacc |
15488878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 521 - 642
Target Start/End: Original strand, 40592311 - 40592430
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||| |||||||||||||||||||||||| ||||||| || ||||| || |||||| |
|
|
| T |
40592311 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggtcggatgccatgaccggggttcgaatcccggtatctccacttgtgcgtgtga |
40592408 |
T |
 |
| Q |
621 |
gtttataatggctttgccattt |
642 |
Q |
| |
|
||||||||| ||||||||||| |
|
|
| T |
40592409 |
gtttataataactttgccattt |
40592430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 522 - 640
Target Start/End: Complemental strand, 42160386 - 42160266
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcact----tatgtgtg |
617 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||||||||| ||||| |||||||||||||||||||||| |||| |||||||| |
|
|
| T |
42160386 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccacttatgtatgtgtg |
42160289 |
T |
 |
| Q |
618 |
tgagtttataatggctttgccat |
640 |
Q |
| |
|
|||||||||||||| |||||||| |
|
|
| T |
42160288 |
tgagtttataatggttttgccat |
42160266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 549 - 650
Target Start/End: Complemental strand, 12541440 - 12541339
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||| |||||||||||||| |||||| ||||| ||||||||||||| |||||||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12541440 |
aaaataccgaaattgttaggtcggatgtcatgatcggggttcgaacctcggtaccttcacttgtgtgtgtgagtttataatggctttgtcatttcgtcta |
12541341 |
T |
 |
| Q |
649 |
tc |
650 |
Q |
| |
|
|| |
|
|
| T |
12541340 |
tc |
12541339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 525 - 653
Target Start/End: Complemental strand, 16368814 - 16368688
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||||||||||| ||||||||| | ||||||||||||||||||||| ||||| ||||||| |||| ||||||||| ||||||||||| ||||||| |
|
|
| T |
16368814 |
cagaagtcctagctcatctggcaaaata--ccgaaattgttaggccggatgtcatgatcggggtttgaactccggtacctccacttatgtgtatgagttt |
16368717 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||| |||| |||||| |||||||||| |
|
|
| T |
16368716 |
ataatgactttaccattttgtctatctac |
16368688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 526 - 654
Target Start/End: Complemental strand, 34242576 - 34242450
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||||||||| ||| | |||||||||||||||||||||||||| ||||| |||||||||||||||||||||| ||||| |||| ||||||| | |
|
|
| T |
34242576 |
agaagtcctagctcaactg--ataaaatgccgaaattgttaggccggatatcatgatcggggttcgaaccccggtacctccacttgtgtgcgtgagttaa |
34242479 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||| | ||||||||||| |
|
|
| T |
34242478 |
taatggctttgccatgtagtctatctacc |
34242450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 35687915 - 35687786
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||| | ||||||||||||||||||||||||||||||||| |||| ||||||| |||||| || ||||||||||| | || |
|
|
| T |
35687915 |
atccagaagtcctagctcaactg--ataaaatgccgaaattgttaggccggatgccatgatcgggattcgaactccggta-ctccacttatgtgtataag |
35687819 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||| |
|
|
| T |
35687818 |
tttataatgactttgtcatttcgtctatctacc |
35687786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 35706851 - 35706981
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| || ||||||||||||| |||||| |||||| |||||||||||| | |||| | ||||||||||||||| |
|
|
| T |
35706851 |
atccagaagtcctagctcaactggcaaaa--tgtcgaaattgttaggtcggatgtcatgactggggttcgaacctcagtacttctacttatgtgtgtgag |
35706948 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |
|
|
| T |
35706949 |
tttataatgactttgccgtttcgtctatctacc |
35706981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 73; E-Value: 7e-33
Query Start/End: Original strand, 574 - 654
Target Start/End: Original strand, 36754997 - 36755077
Alignment:
| Q |
574 |
tgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36754997 |
tgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtctatctacc |
36755077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 554 - 641
Target Start/End: Original strand, 8532135 - 8532222
Alignment:
| Q |
554 |
gccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatt |
641 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
8532135 |
gccgaaattgttaggccggatgctatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatgactttgccatt |
8532222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 525 - 654
Target Start/End: Original strand, 38463141 - 38463269
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||| ||||||| ||||||||| |||||||||||||||| |||||| |||| |||||||||||||||| ||||| ||||| ||||||||| ||| |
|
|
| T |
38463141 |
cagaagtcttagctcaactggcaaaa--tgccgaaattgttaggtcggatgttatgatcggggttcgaaccccgatacctccacttgtgtgtgtgaattt |
38463238 |
T |
 |
| Q |
625 |
ataatggctttgcca-tttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |
|
|
| T |
38463239 |
ataatggctttgccattttcgtctatctacc |
38463269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 72; E-Value: 3e-32
Query Start/End: Original strand, 516 - 654
Target Start/End: Original strand, 39310359 - 39310495
Alignment:
| Q |
516 |
tatagtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtg |
615 |
Q |
| |
|
|||||||| |||||||||||||||| || |||||| || |||||||||||||||||||| |||| |||||||||||| |||||| || ||||| |||| |
|
|
| T |
39310359 |
tatagtattcagaagtcctagctcaactagcaaaatat--cgaaattgttaggccggatgttatgatcggggttcgaactccggtaactccacttgtgtg |
39310456 |
T |
 |
| Q |
616 |
tgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||| |||| |
|
|
| T |
39310457 |
tgtgagtttataatagctttgtcatttcgtctatatacc |
39310495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 548 - 654
Target Start/End: Original strand, 6590906 - 6591012
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||||| || |||||||||| |||||||||||||||||||||||||| ||| ||||||||| | |
|
|
| T |
6590906 |
aaaaatgcagaaattgttaggccggatgttatgaccggggttcaaatcccggtacctccacttatgtgtgtgagtttataatggttttaccatttcgttt |
6591005 |
T |
 |
| Q |
648 |
atctacc |
654 |
Q |
| |
|
||||||| |
|
|
| T |
6591006 |
atctacc |
6591012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 7958113 - 7957985
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| | ||||||||||| |||||||||||||||||||||||| || ||| ||| || |||| |||||||||| |
|
|
| T |
7958113 |
atccagaagtcctagctcaactggcaaaata--ccgaaattgttgggccggatgccatgaccggggttcaaaacccagtatctccact--tgtgtgtgag |
7958018 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||| |
|
|
| T |
7958017 |
tttataatagctttgtcatttcgtctatctacc |
7957985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 18999327 - 18999458
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||||||||| |||| ||||||||| |||||||||||||||| |||||||||| | || |||||||||||||| ||| ||||| ||||||||| |
|
|
| T |
18999327 |
tatccagaagtcctaactcaactggcaaaa--tgccgaaattgttaggtcggatgccattattggagttcgaaccccggttcctccacttgtgtgtgtga |
18999424 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||| ||| ||||| ||||||||||||||||| |
|
|
| T |
18999425 |
gtttattatgactttgtcatttcgtctatctacc |
18999458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 31054046 - 31054177
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||| ||||||||||| ||||||||| || ||| ||||||||||||||||||| |||||||||||||| || |||| || | ||| ||||||||| |
|
|
| T |
31054046 |
tatccagaggtcctagctcaactggcaaaa--tgtcgatattgttaggccggatgccaagaccggggttcgaatccaggtatctccgcttgtgtgtgtga |
31054143 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||| |
|
|
| T |
31054144 |
gtttattatggctttgtcatttcgtctatctacc |
31054177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 4772302 - 4772432
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| ||||| ||||||| ||||||||| ||| ||||||||||||||||||||||||||||||||||||| |||||||| ||||| |||| ||| |
|
|
| T |
4772302 |
atccataagtcatagctcaactggcaaaa--tgctgaaattgttaggccggatgccatgaccggggttcgaatttcggtacctccacttgtgtgatagag |
4772399 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
4772400 |
tttacaatggctttgccatttcgtctatctacc |
4772432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 10202194 - 10202299
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||| |||||||||||| | |||||| ||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10202194 |
aaaatgtcgaaattgttaggccggatgctatgatcggggttcgaacttcagtacctccacttatatgtgtgagtttataatggctttgtcatttcgtcta |
10202293 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
10202294 |
tctacc |
10202299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 521 - 652
Target Start/End: Complemental strand, 16535073 - 16534944
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||| ||| ||| | |||||| |||||||||||||||||||| ||||| ||| ||||||||||||||| || ||||| |||||||| |
|
|
| T |
16535073 |
tatccagaagtcctagttcaactg--ataaaatgtcgaaattgttaggccggatgtcatgatcggagttcgaaccccggtaactccacttgggtgtgtga |
16534976 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| |
|
|
| T |
16534975 |
gtttataatagctttgtcatttcgtctatcta |
16534944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 18779935 - 18780039
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag-tttataatggctttgccatttcgtct |
647 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||| || |||||||| |||||||| |||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
18779935 |
aaaatgtcgaaattgttaggtcggatgccatgaccaggcttcgaaccacggtacctccacttatgtgtgtgagttttataatgactttgccatttcgtct |
18780034 |
T |
 |
| Q |
648 |
atcta |
652 |
Q |
| |
|
||||| |
|
|
| T |
18780035 |
atcta |
18780039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 68; E-Value: 6e-30
Query Start/End: Original strand, 579 - 654
Target Start/End: Complemental strand, 36216827 - 36216752
Alignment:
| Q |
579 |
tgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36216827 |
tgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtctatctacc |
36216752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 11816906 - 11816775
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||| |||| || ||||||||||||||||||||| || | | ||||||||||||||||||| ||||| ||||||| | |
|
|
| T |
11816906 |
tatccagaagtcctagctcaattggtaaaa--tgtcgaaattgttaggccggatgctattattgaggttcgaaccccggtacctccacttgtgtgtgtaa |
11816809 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||| |
|
|
| T |
11816808 |
gtttataatggctttgtcatttcatctatctacc |
11816775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 19134647 - 19134517
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||| ||||||||||||| |||| |||||||| ||||||||||||||| |||||| ||||||| |||||||||||| ||||| |||| ||||||||| |
|
|
| T |
19134647 |
tatccataagtcctagctcaactgg-aaaaaatgtcgaaattgttaggccagatgccgtgaccggagttcgaaccccgatacctccact--tgtgtgtga |
19134551 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| |||||| |||| ||| |||||||| |
|
|
| T |
19134550 |
gtttataatcgctttgtcattccgtttatctacc |
19134517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 548 - 654
Target Start/End: Complemental strand, 30854840 - 30854734
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||| ||||||||||||| || ||| ||||||||||| |||||||||||||||||||||| |||||||||||||||||| | |||| |||||||||| |
|
|
| T |
30854840 |
aaaaatgtcgaaattgttaggacgaatgtcatgaccggggctcgaaccccggtaccttcacttgtgtgtgtgagtttataattgttttgtcatttcgtct |
30854741 |
T |
 |
| Q |
648 |
atctacc |
654 |
Q |
| |
|
|| |||| |
|
|
| T |
30854740 |
atgtacc |
30854734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 31525082 - 31524951
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||| |||| |||||||| ||| ||||| |||||||||||||| |||| | |||||||||| |||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
31525082 |
tatccacaagttctagctcaactgacaaaa--tgccgaaattgttatgccgaaaaccatgaccggagttcgaaccccgttacctccacttgtgtgtgtga |
31524985 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||| |
|
|
| T |
31524984 |
gtttataatgactttgccatttcgtctatatacc |
31524951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 67; E-Value: 3e-29
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 39218680 - 39218811
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| | | ||||||||||||||||||||| |||||| |||| |||||||||||||||||||||| ||||| | |||||||| |
|
|
| T |
39218680 |
atccagaagtcctagctcaattcg--aaaaatgccgaaattgttaggtcggatgttatgatcggggttcgaaccccggtacctccacttgtatgtgtgag |
39218777 |
T |
 |
| Q |
622 |
-tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||| |
|
|
| T |
39218778 |
ttttataatgactttgtcatttcgtctatctacc |
39218811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 549 - 654
Target Start/End: Complemental strand, 7315865 - 7315760
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||| ||||||||||| |||||| |||||| ||||||||||| ||||||||| |||||||||||||||||||||||| ||||| ||||||| |||| |
|
|
| T |
7315865 |
aaaatgctgaaattgttagaccggataccatgattggggttcgaactccggtacctccacttatgtgtgtgagtttataatagctttaccatttcatcta |
7315766 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
7315765 |
tctacc |
7315760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 519 - 652
Target Start/End: Original strand, 18055854 - 18055986
Alignment:
| Q |
519 |
agtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgt |
618 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||| || | |||||| ||||||||||| ||||| ||||||||||||| || ||||| || || ||||||| |
|
|
| T |
18055854 |
agtatccataagtcctagctcaattggcaaaaa-tgtcaaaattgctaggccggatgtcatgatcggggttcgaaccgcgttacctccatttgtgtgtgt |
18055952 |
T |
 |
| Q |
619 |
gagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| |
|
|
| T |
18055953 |
gagtttataatgactttgtcatttcgtctatcta |
18055986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 41196987 - 41197092
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| ||| | || ||||||||||||||||| ||| ||||||||||| |||| |
|
|
| T |
41196987 |
aaaatgccgaaattgttaagccggatgccatgaccggggttcgaaccccgatacttccatttatgtgtgtgagtttacaataactttgccattttatcta |
41197086 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
41197087 |
tctacc |
41197092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 525 - 652
Target Start/End: Complemental strand, 42133568 - 42133442
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag-tt |
623 |
Q |
| |
|
|||||||| ||| ||| ||||||||| |||||||||||||||| ||||||||||||| ||||||||| |||| ||||| ||||| ||| |||||| || |
|
|
| T |
42133568 |
cagaagtcttagttcaactggcaaaa--tgccgaaattgttaggtcggatgccatgactagggttcgaatcccgatacctccacttgtgtttgtgagttt |
42133471 |
T |
 |
| Q |
624 |
tataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42133470 |
tataatggctttgccatttcgtctatcta |
42133442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 521 - 652
Target Start/End: Complemental strand, 31516335 - 31516206
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||| |||||||| |||| |||| |||||||||||||||||||||||||| |||||| | ||||||||||| |||||| | ||||| |||||||| |
|
|
| T |
31516335 |
tatccacaagtcctaactcaactgg--aaaaatgccgaaattgttaggccggaaaccatgatcagggttcgaacctcggtacatccacttttgtgtgtgt |
31516238 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |
|
|
| T |
31516237 |
gtttataatgagtttgccatttcgtctatcta |
31516206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 548 - 652
Target Start/End: Original strand, 33898254 - 33898357
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||||||| ||| |||||| ||||| ||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
33898254 |
aaaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaatccc-gtacctccacttgtgtgtgtgagtttataatgactttgtcatttcgtcc |
33898352 |
T |
 |
| Q |
648 |
atcta |
652 |
Q |
| |
|
||||| |
|
|
| T |
33898353 |
atcta |
33898357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 550 - 654
Target Start/End: Complemental strand, 36685506 - 36685402
Alignment:
| Q |
550 |
aaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
||||| |||||||||||||||||||| ||||| |||||||||||||| | ||||| ||||| |||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
36685506 |
aaatgtcgaaattgttaggccggatgtcatgatcggggttcgaaccctgatacctccacttgtgtgtgtgagtttataataactttgtcatttcgtctat |
36685407 |
T |
 |
| Q |
650 |
ctacc |
654 |
Q |
| |
|
||||| |
|
|
| T |
36685406 |
ctacc |
36685402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 559 - 654
Target Start/End: Complemental strand, 8293649 - 8293554
Alignment:
| Q |
559 |
aattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||| |||| || |||||||| |||| ||||| ||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
8293649 |
aattgttaggccggatgctatgatcgaggttcgaatcccgatacctccacttatgtgtgtgaatttataatggctttgtcatttcgtctatctacc |
8293554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 529 - 654
Target Start/End: Complemental strand, 12221267 - 12221145
Alignment:
| Q |
529 |
agtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataa |
628 |
Q |
| |
|
|||||||||||| |||||||||| || ||||||||||||||||| ||||||||| ||||||||||||| |||||| |||| ||||||||||||||||| |
|
|
| T |
12221267 |
agtcctagctcaactggcaaaaa-tgatgaaattgttaggccggacgccatgaccagggttcgaaccccagtacctccact--tgtgtgtgagtttataa |
12221171 |
T |
 |
| Q |
629 |
tggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
| | |||| ||||||||||| ||||| |
|
|
| T |
12221170 |
tagttttgtcatttcgtctacctacc |
12221145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 560 - 653
Target Start/End: Original strand, 5887603 - 5887696
Alignment:
| Q |
560 |
attgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||| | ||||||| ||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5887603 |
attgttaggccggatgtcatgaccagggttcgaactctggtacctccacttatatgtgtgagtttataatggctttatcatttcgtctatctac |
5887696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 29741087 - 29740957
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| |||| ||||||| ||||||| ||||| |||| ||| | |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
29741087 |
atccagaagtcctagctcaactgg--aaaaatgtcgaaattattaggttggatatcataattggggttcgaatcccggtaccttcacttatgtgtgtgag |
29740990 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||| |||| ||||| |||||||| |||||||| |
|
|
| T |
29740989 |
tttacaatgactttgtcatttcgtttatctacc |
29740957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 61; E-Value: 1e-25
Query Start/End: Original strand, 549 - 649
Target Start/End: Complemental strand, 8859391 - 8859291
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||| ||||||||||||||| ||||| ||||| ||||||| ||||||||||| ||||| ||||||||||| |
|
|
| T |
8859391 |
aaaatgtcgaaattgttaggccggatgtcatgattggggttcgaaccccgatacctccacttgtgtgtgtcagtttataatgactttgtcatttcgtcta |
8859292 |
T |
 |
| Q |
649 |
t |
649 |
Q |
| |
|
| |
|
|
| T |
8859291 |
t |
8859291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 521 - 654
Target Start/End: Complemental strand, 21840578 - 21840448
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||| |||| || ||||||||||| | |||| ||||| ||||||||||| |||| ||||| ||||| |||| |||| |
|
|
| T |
21840578 |
tatccagaagtcctagctcaactgacaaa---tgtcgaaattgttaagttggatatcatgatcggggttcgaatcccgatacctccacttgtgtgggtga |
21840482 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
21840481 |
gtttataatggctttgccatttcttctatctacc |
21840448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 555 - 654
Target Start/End: Original strand, 35493691 - 35493790
Alignment:
| Q |
555 |
ccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||| | ||| || ||||||||| ||||||||| ||||| ||||||||| ||||||||||||||| |||||| |||||||||| |
|
|
| T |
35493691 |
ccgaaattgttaggccggatgtcgtgatcgaggttcgaactccggtacctccacttgtgtgtgtgaatttataatggctttgtcatttcatctatctacc |
35493790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 521 - 648
Target Start/End: Original strand, 433136 - 433261
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
||||||||||||||| |||| ||| ||||| || |||||||||||||| ||||||| ||| | |||||||||||| | ||| ||||| ||||||||| |
|
|
| T |
433136 |
tatccagaagtcctaactcaactgacaaaa--tgtcgaaattgttaggctggatgccgtgattgaagttcgaaccccgattcctccacttgtgtgtgtga |
433233 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||| ||||||||||| |
|
|
| T |
433234 |
gtttataatggctttgtcatttcgtcta |
433261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 521 - 652
Target Start/End: Original strand, 42211276 - 42211405
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||| ||| ||| |||| |||| || |||||||||||||||| |||| ||||||||| ||||||||||| ||||| || |||||| ||||| |
|
|
| T |
42211276 |
tatccagaagtcttagttcaactggtaaaa--tgtcgaaattgttaggccgcatgctatgaccgggattcgaaccccgatacctccatttatgtatgtga |
42211373 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||| |||| | |||| ||||||||||||||| |
|
|
| T |
42211374 |
gtttttaatagttttgtcatttcgtctatcta |
42211405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 571 - 654
Target Start/End: Original strand, 44276309 - 44276392
Alignment:
| Q |
571 |
ggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||| ||||| ||||||||||||||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44276309 |
ggatgtcatgattggggttcgaaccccggtttctccacttgtgtgtgtgagtttataatggctttgccatttcgtctatctacc |
44276392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 558 - 652
Target Start/End: Original strand, 17882747 - 17882841
Alignment:
| Q |
558 |
aaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||| || ||||| |||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
17882747 |
aaattgttaggctggatgccatgactagggttcgaaccccggtgtctccacttttgtgtgtgagtttataataactttgcaatttcgtctatcta |
17882841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 549 - 653
Target Start/End: Original strand, 13774488 - 13774590
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||| ||||||||||||||| ||||| |||| || | ||||||| ||| ||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13774488 |
aaaataccgaaattgttaggctggatgttatgatcgagattcgaactccgataccttcactt--gtgtgtgagtttataatggctttcccatttcgtcta |
13774585 |
T |
 |
| Q |
649 |
tctac |
653 |
Q |
| |
|
||||| |
|
|
| T |
13774586 |
tctac |
13774590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 528 - 652
Target Start/End: Original strand, 31819643 - 31819765
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttata |
627 |
Q |
| |
|
|||||||| |||| ||||||||| || ||||||| |||||||||||| |||||||| ||||| || | ||||| |||||||||||||||||||||| |
|
|
| T |
31819643 |
aagtcctaactcaactggcaaaa--tgtcgaaattattaggccggatggcatgaccgaagttcgtttcctgatacctccacttatgtgtgtgagtttata |
31819740 |
T |
 |
| Q |
628 |
atggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|| |||||| ||||||||||||||| |
|
|
| T |
31819741 |
atagctttgtcatttcgtctatcta |
31819765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 522 - 652
Target Start/End: Complemental strand, 499887 - 499755
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggta---ccttcacttatgtgtgt |
618 |
Q |
| |
|
||||||| ||||||| ||| ||||||||| |||||||||||||||| | |||||||||| ||||||||||| ||| || ||| ||| ||||||||| |
|
|
| T |
499887 |
atccagacgtcctagttcaattggcaaaaa-tgccgaaattgttaggtcagatgccatgatcggggttcgaattccgataactcctccacgtatgtgtgt |
499789 |
T |
 |
| Q |
619 |
gagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|| |||||||| | |||||||||||||||||||| |
|
|
| T |
499788 |
gaatttataattgttttgccatttcgtctatcta |
499755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 548 - 654
Target Start/End: Original strand, 22999098 - 22999205
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
||||||||| |||||||||| ||||| | |||||||||||||||||||||| |||| ||| || ||||||||||||||| |||| |||| ||| ||||| |
|
|
| T |
22999098 |
aaaaatgccaaaattgttagtccggacgtcatgaccggggttcgaaccccgacacctccactttgtgtgtgtgagtttatgatggttttgtcatctcgtc |
22999197 |
T |
 |
| Q |
647 |
tatctacc |
654 |
Q |
| |
|
|||||||| |
|
|
| T |
22999198 |
tatctacc |
22999205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 548 - 654
Target Start/End: Complemental strand, 32517923 - 32517816
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
||||||| |||||||||||||| ||| | |||||||| ||||||||||||||||||| ||| || ||||||||||||||| ||| ||||||||| | || |
|
|
| T |
32517923 |
aaaaatgtcgaaattgttaggctggacgtcatgaccgaggttcgaaccccggtacctccactttgtgtgtgtgagtttatgatgactttgccatcttatc |
32517824 |
T |
 |
| Q |
647 |
tatctacc |
654 |
Q |
| |
|
|||||||| |
|
|
| T |
32517823 |
tatctacc |
32517816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 523 - 653
Target Start/End: Original strand, 43696410 - 43696545
Alignment:
| Q |
523 |
tccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatg---ccatgaccggggttcgaaccccggtaccttcactta----tgtg |
615 |
Q |
| |
|
|||| ||||| ||||||| ||| |||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
43696410 |
tccacaagtcttagctcaactg--aaaaaatgccgaaattattaggccggatgtaattatgaccggggttcgaaccccggtacctccacttatgtgtgtg |
43696507 |
T |
 |
| Q |
616 |
tgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||| |||||||||| |||||||||| ||||||||| |
|
|
| T |
43696508 |
tgtgaatttataatggttttgccattttatctatctac |
43696545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 560 - 654
Target Start/End: Original strand, 30413212 - 30413306
Alignment:
| Q |
560 |
attgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| |||||| ||||| || ||||||||| |||||||| ||||||||||| |||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
30413212 |
attgttaggtcggatgtcatgatcgaggttcgaacttcggtacctccacttatgtgtaagagtttataatgactttgtcatttcgtctatctacc |
30413306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 549 - 654
Target Start/End: Complemental strand, 11091690 - 11091585
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||||||| | |||| ||||| |||| |||||| || | ||| | |||| | |||||||||||||||| |||||||||||||||||| |
|
|
| T |
11091690 |
aaaatgccgaaattgttaggtcagatgtcatgatcgggattcgaatcctgatacatctacttgtatgtgtgagtttataatagctttgccatttcgtcta |
11091591 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
11091590 |
tctacc |
11091585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 520 - 653
Target Start/End: Complemental strand, 12847086 - 12846953
Alignment:
| Q |
520 |
gtatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtg |
619 |
Q |
| |
|
|||||||||||| ||| |||| |||| |||| | || |||||||||||| ||||| ||||| | |||||||||||| ||||||| | ||| |||||||| |
|
|
| T |
12847086 |
gtatccagaagttctaactcaactggtaaaata--ccaaaattgttaggctggatgtcatgatcagggttcgaaccctggtacctcctcttgtgtgtgtg |
12846989 |
T |
 |
| Q |
620 |
--agtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||| |
|
|
| T |
12846988 |
tgagtttatcatggttttgccatttcgtctatctac |
12846953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 530 - 654
Target Start/End: Original strand, 39417449 - 39417572
Alignment:
| Q |
530 |
gtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttataa |
628 |
Q |
| |
|
||||||||||| ||| |||||| | ||||||||||||||||||||| ||||| |||||||||||| ||| || || ||| |||||||||||||||||| | |
|
|
| T |
39417449 |
gtcctagctcaactgacaaaaa-taccgaaattgttaggccggatgtcatga-cggggttcgaactccgatatctccactttatgtgtgtgagtttatga |
39417546 |
T |
 |
| Q |
629 |
tggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|| |||| ||| ||||||||||||| |
|
|
| T |
39417547 |
tgactttatcatctcgtctatctacc |
39417572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 522 - 652
Target Start/End: Original strand, 11011975 - 11012102
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| ||||||||||||| || ||||| ||| ||||||||||||| ||||||||||| ||| ||||||||||| |||| | ||||| | |||||||| |
|
|
| T |
11011975 |
atccacaagtcctagctcaactagcaaa---tgctgaaattgttaggctggatgccatgatcggagttcgaaccccagtacttccacttgtatgtgtgag |
11012071 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||| || | ||||||| |||||| |
|
|
| T |
11012072 |
tttataatggtttggtgatttcgtttatcta |
11012102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 549 - 621
Target Start/End: Original strand, 38140715 - 38140787
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||| |||||||||||||||||||||| || || |||||||||| |
|
|
| T |
38140715 |
aaaatgccgaaattgttaagccggatgtcatgatcggggttcgaaccccggtacctccatttgtgtgtgtgag |
38140787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 528 - 654
Target Start/End: Original strand, 13491030 - 13491156
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttat |
626 |
Q |
| |
|
||||| ||||||| |||||||||| | |||||||||||| |||||| | ||||||||||||||||||| | ||||| ||| || ||||||||||||||| |
|
|
| T |
13491030 |
aagtcatagctcaactggcaaaaa-taccgaaattgttatgccggacgtcatgaccggggttcgaacctcaatacctccactttgtgtgtgtgagtttat |
13491128 |
T |
 |
| Q |
627 |
aatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||| || ||||| |||| |
|
|
| T |
13491129 |
ggtggctttgccatctcttctatatacc |
13491156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 528 - 654
Target Start/End: Complemental strand, 40710959 - 40710833
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttat |
626 |
Q |
| |
|
||||||||||||| ||||||||| | ||||||| |||| ||| | |||||||||||||||||||||||||||| ||| || ||| |||| |||||| |
|
|
| T |
40710959 |
aagtcctagctcaattggcaaaaa-taccgaaataattagagtggacgtcatgaccggggttcgaaccccggtacctccactttgtgtttgtgtgtttat |
40710861 |
T |
 |
| Q |
627 |
aatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||| |||||||||||||||| |
|
|
| T |
40710860 |
gatggctttgcaatttcgtctatctacc |
40710833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 600 - 654
Target Start/End: Original strand, 19593598 - 19593652
Alignment:
| Q |
600 |
taccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19593598 |
tacctccacttatgtgtgtgagtttataatggctttgccatttcgtttatctacc |
19593652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 528 - 653
Target Start/End: Original strand, 19967739 - 19967862
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttata |
627 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||||||| |||| | ||||| | | |||||||| ||| ||||| ||||| ||||||||||||||| |
|
|
| T |
19967739 |
aagtcctagctcaactggcaaaata--ccgaaattgttaagccgaacgccattatcaaggttcgaattccgatacctccacttgcgtgtgtgagtttata |
19967836 |
T |
 |
| Q |
628 |
atggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||| ||||| |||||||||||||||| |
|
|
| T |
19967837 |
atgactttgtcatttcgtctatctac |
19967862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 591 - 653
Target Start/End: Original strand, 44887180 - 44887242
Alignment:
| Q |
591 |
gaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||| |||||| ||||| ||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44887180 |
gaaccccagtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtccatctac |
44887242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 528 - 617
Target Start/End: Original strand, 18251377 - 18251466
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtg |
617 |
Q |
| |
|
|||||||| |||| ||| | ||||||||| |||||||||| ||| ||||||||| |||||||||||||| ||||||| ||||| |||||| |
|
|
| T |
18251377 |
aagtcctaactcaactgaccaaaaatgccaaaattgttagaccgaatgccatgatcggggttcgaaccctggtacctccacttgtgtgtg |
18251466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 526 - 649
Target Start/End: Complemental strand, 25510427 - 25510308
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||||||||| |||| |||| | ||||||||||||||||||| ||| | || | |||||||||||| | ||| ||||| |||||||| |||| |
|
|
| T |
25510427 |
agaagtcctagctcaactggtaaaata--ccgaaattgttaggccggacgccttcacggaggttcgaacccccgcccctccactt--gtgtgtgaattta |
25510332 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctat |
649 |
Q |
| |
|
||||||||||| |||||||||||| |
|
|
| T |
25510331 |
taatggctttgtcatttcgtctat |
25510308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 41520522 - 41520627
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||||| |||||||||||| | |||| ||||| ||||||| ||| |||| ||||| || || ||||| ||||||||||||| |||||| ||||||||| |
|
|
| T |
41520522 |
aaaatgctgaaattgttaggtcagatgtcatgatcggggtttgaatcccgatacctccatttgtgtgtatgagtttataatgattttgccttttcgtcta |
41520621 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
|||||| |
|
|
| T |
41520622 |
tctacc |
41520627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 558 - 654
Target Start/End: Original strand, 1910834 - 1910930
Alignment:
| Q |
558 |
aaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||| ||| || || | || ||||||||| ||||||||| ||||||||||| ||||||||||| |
|
|
| T |
1910834 |
aaattattaggccggatgttatgaccggggttcgaactccgatatctcaatttgtgtgtgtgaatttataatgactttgccattttgtctatctacc |
1910930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 522 - 652
Target Start/End: Complemental strand, 4695121 - 4694995
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
|||||||| |||||||| | ||||||||| || |||||||||| || |||||| ||||| | ||||||||||||| || || || || |||| |||| |
|
|
| T |
4695121 |
atccagaaatcctagcttaactggcaaaa--tgtcgaaattgttcggtcggatgtcatgatcagggttcgaaccccagtgtctccattt--gtgtttgag |
4695026 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |
|
|
| T |
4695025 |
tttataatggctttaccatttcgtctatcta |
4694995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 526 - 636
Target Start/End: Original strand, 32120613 - 32120718
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||||||||| ||||||||| ||| |||||||||||||||||| |||||| |||||||||||||| ||||| |||| |||||| ||||||| |
|
|
| T |
32120613 |
agaagtcctagctcaactggcaaaa--tgc-gaaattgttaggccggataccatgatcggggttcgaaccc--ttacctctacttgtgtgtgagagttta |
32120707 |
T |
 |
| Q |
626 |
taatggctttg |
636 |
Q |
| |
|
||||| ||||| |
|
|
| T |
32120708 |
taatgactttg |
32120718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 587 - 654
Target Start/End: Complemental strand, 2477011 - 2476944
Alignment:
| Q |
587 |
gttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||| ||| |||||| ||||| |||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
2477011 |
gttcgaatcccagtacctccacttgtgtgtgtgagtttataatggctatgtcatttcgtctatctacc |
2476944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 556 - 652
Target Start/End: Original strand, 6598431 - 6598523
Alignment:
| Q |
556 |
cgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||||||| ||||| ||| ||||||||||| |||||| |||||| ||||| ||||||||| ||||| ||||||||||||||| |
|
|
| T |
6598431 |
cgaaattgttaggccggatatcatgatcggcgttcgaaccccagtacctccactta----tgtgaatttataatgactttgtcatttcgtctatcta |
6598523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 587 - 654
Target Start/End: Original strand, 23840879 - 23840946
Alignment:
| Q |
587 |
gttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||| ||||||| ||||| ||||||||||||||||||| |||||| ||||| |||||||||| |
|
|
| T |
23840879 |
gttcgaaccctggtacctccacttgtgtgtgtgagtttataatgactttgctatttcatctatctacc |
23840946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 523 - 653
Target Start/End: Original strand, 816349 - 816475
Alignment:
| Q |
523 |
tccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcactta-tgtgtgtgag |
621 |
Q |
| |
|
|||| ||||| ||||||| |||||||||| |||| ||||||||||| || ||||||| ||||||||||||||||| | ||||| |||||||||| |
|
|
| T |
816349 |
tccataagtcatagctcaactggcaaaaa-tgccaaaattgttaggtcgt----catgaccatggttcgaaccccggtacatccactttgtgtgtgtgag |
816443 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||| |||| |||||||| |||||||||||| |
|
|
| T |
816444 |
tttatgatggttttgccatctcgtctatctac |
816475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 548 - 653
Target Start/End: Original strand, 13622978 - 13623081
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||| |||||||||||| ||| ||| ||| |||||||||||||| ||||| ||||| |||| |
|
|
| T |
13622978 |
aaaattgccgaaattgttaggccggatgccgtgaccggagttcgaaccccgactcctatact--tgtaggtgagtttataatgactttgtcattttgtct |
13623075 |
T |
 |
| Q |
648 |
atctac |
653 |
Q |
| |
|
|||||| |
|
|
| T |
13623076 |
atctac |
13623081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 549 - 649
Target Start/End: Original strand, 12400668 - 12400766
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
||||| || ||| |||||||||||||||||||| ||||||||||| || | |||||||||| |||||||||| ||| |||| |||| ||||||||||| |
|
|
| T |
12400668 |
aaaataccaaaactgttaggccggatgccatgatcggggttcgaatcctgataccttcact--tgtgtgtgagcttacaatgactttatcatttcgtcta |
12400765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 558 - 653
Target Start/End: Complemental strand, 7907025 - 7906932
Alignment:
| Q |
558 |
aaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||| |||| | | |||| |||| ||||||||| | |||| ||||| ||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
7907025 |
aaattgttaggtcggacgtcgtgactggggatcgaaccccagcacctccacttgtgtgtgtgagtttat--tggctttgccatttcgtttatctac |
7906932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 564 - 650
Target Start/End: Original strand, 17052596 - 17052683
Alignment:
| Q |
564 |
ttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttataatggctttgccatttcgtctatc |
650 |
Q |
| |
|
|||||||||| | |||||||||||||| ||| ||||||||| ||| || ||||||||| ||||| ||||||||||||| || |||||| |
|
|
| T |
17052596 |
ttaggccggacgtcatgaccggggttcaaactccggtacctccactttgtgtgtgtgaatttatgatggctttgccatctcttctatc |
17052683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 601 - 652
Target Start/End: Complemental strand, 32738356 - 32738305
Alignment:
| Q |
601 |
accttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
32738356 |
accttcacttgtgtgtgtgagtttataatggttttgccatttcatctatcta |
32738305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 528 - 594
Target Start/End: Original strand, 3680862 - 3680928
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaac |
594 |
Q |
| |
|
||||||||||||| | |||||||||||| |||||||||||| | || | |||||||||||||||||| |
|
|
| T |
3680862 |
aagtcctagctcaaccggcaaaaaatgcagaaattgttaggtcagacgtcatgaccggggttcgaac |
3680928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 528 - 597
Target Start/End: Original strand, 16178264 - 16178331
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaacccc |
597 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||| ||| ||||||| ||||||||||||||| |
|
|
| T |
16178264 |
aagtcctagctcaactg--aaaaaatgccgaaattgttaggtaggacgccatgatcggggttcgaacccc |
16178331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 522 - 654
Target Start/End: Original strand, 42030243 - 42030372
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| | | |||||| ||||||||||||| |||||| ||||| | | ||||||| ||| | ||| ||||| ||||| | || |
|
|
| T |
42030243 |
atccagaagtcctagctcaacggt---aaaatgtcgaaattgttaggtcggatgtcatgattgagattcgaactccgtttcctccacttgtgtgtataag |
42030339 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||| |||| ||||||||| |||||||| |
|
|
| T |
42030340 |
tttataatgactttaccatttcgtttatctacc |
42030372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 522 - 583
Target Start/End: Complemental strand, 7607370 - 7607310
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgacc |
583 |
Q |
| |
|
||||||||||||||||||| || |||||| || |||||||||||||||||||||||||||| |
|
|
| T |
7607370 |
atccagaagtcctagctcaattgacaaaaa-tgtcgaaattgttaggccggatgccatgacc |
7607310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 548 - 652
Target Start/End: Complemental strand, 18741503 - 18741398
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcactta-tgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
||||||||||||||||||||| || | ||||| || ||||| ||| ||||||||| ||||| ||||||||||||||| ||| ||||| ||| ||||| |
|
|
| T |
18741503 |
aaaaatgccgaaattgttaggtcgaacatcatgatcgaggttcaaactccggtacctccactttgtgtgtgtgagtttatgatgactttgtcatctcgtc |
18741404 |
T |
 |
| Q |
647 |
tatcta |
652 |
Q |
| |
|
|||||| |
|
|
| T |
18741403 |
tatcta |
18741398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 556 - 649
Target Start/End: Complemental strand, 19954995 - 19954903
Alignment:
| Q |
556 |
cgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
||||||||||| | |||||| ||||| ||| |||||||||||| ||||| |||| ||||||||||||||| ||| ||||| ||| |||||||| |
|
|
| T |
19954995 |
cgaaattgttaagtcggatgtcatgatcggagttcgaaccccgatacctctactt-tgtgtgtgagtttatgatgactttgtcatctcgtctat |
19954903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 547 - 635
Target Start/End: Complemental strand, 25219742 - 25219654
Alignment:
| Q |
547 |
aaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttataatggcttt |
635 |
Q |
| |
|
|||||||| |||||||||||||||||| | ||||| |||| ||||||| | ||||||| ||| |||| |||||||||||||||| ||||| |
|
|
| T |
25219742 |
aaaaaatgtcgaaattgttaggccggacgtcatga-cgggattcgaactcaggtacctccactttatatgtgtgagtttataatagcttt |
25219654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 7929069 - 7929176
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgt--gagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
|||||||||||||| ||| |||||| | ||||| |||||||||||| ||| |||| | |||||||||| |||||||||||| | || ||||||||| |
|
|
| T |
7929069 |
aaaatgccgaaattattaagccggacgtcatgatcggggttcgaactccgacacctccgtttatgtgtgtgagagtttataatgacactgtcatttcgtc |
7929168 |
T |
 |
| Q |
647 |
tatctacc |
654 |
Q |
| |
|
|||||||| |
|
|
| T |
7929169 |
tatctacc |
7929176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 528 - 635
Target Start/End: Complemental strand, 25219967 - 25219860
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttat |
626 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||| |||| | ||||| |||||||| || |||| ||||| ||| |||||||||||| ||||| |
|
|
| T |
25219967 |
aagtcctagctcaattgataaaaaatgccgaaattgttaggtcggacgtcatga-cggggttcaaatcccgatacctccactttatgtgtgtgaatttat |
25219869 |
T |
 |
| Q |
627 |
aatggcttt |
635 |
Q |
| |
|
|| ||||| |
|
|
| T |
25219868 |
gatagcttt |
25219860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 577 - 649
Target Start/End: Complemental strand, 43841788 - 43841716
Alignment:
| Q |
577 |
catgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
||||| ||| |||||||| ||| ||||| ||||| ||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
43841788 |
catgatcggagttcgaactccgatacctccacttgtgtgtgtgagtttataatgactttctcatttcgtctat |
43841716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 618 - 653
Target Start/End: Original strand, 9160923 - 9160958
Alignment:
| Q |
618 |
tgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
9160923 |
tgagtttataatggctttgccatttcgtctatctac |
9160958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 558 - 636
Target Start/End: Original strand, 6738784 - 6738862
Alignment:
| Q |
558 |
aaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttg |
636 |
Q |
| |
|
||||||||| | |||||| ||| | ||| ||| ||| ||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
6738784 |
aaattgttaagtcggatgtcataatcggaattcaaactccggtacctccacttatgtgtgggagtttataatggctttg |
6738862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 578 - 616
Target Start/End: Original strand, 36241171 - 36241209
Alignment:
| Q |
578 |
atgaccggggttcgaaccccggtaccttcacttatgtgt |
616 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36241171 |
atgaccggggttcgaaccgcggtaccttcacttatgtgt |
36241209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 616 - 653
Target Start/End: Complemental strand, 7607303 - 7607266
Alignment:
| Q |
616 |
tgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7607303 |
tgtgaggttataatggctttgccatttcgtctatctac |
7607266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 528 - 640
Target Start/End: Original strand, 37103326 - 37103438
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttc-acttatgtgtgtgagtttat |
626 |
Q |
| |
|
||||||||||||| ||| |||||| || |||||||||||| ||||| ||||||||||||| |||||||| ||||| | || ||||||||| ||||| |
|
|
| T |
37103326 |
aagtcctagctcaactgacaaaaa-tgtcgaaattgttagaccggacatcatgaccggggtttgaaccccgatacctccgttttgtgtgtgtgaatttat |
37103424 |
T |
 |
| Q |
627 |
aatggctttgccat |
640 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
37103425 |
gatgactttgccat |
37103438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 584 - 652
Target Start/End: Complemental strand, 38082975 - 38082909
Alignment:
| Q |
584 |
ggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||| |||||| ||| |||||||||||||||||||| |||| ||||||||| |||||| |
|
|
| T |
38082975 |
ggggttcgaaccctagtacctccac--atgtgtgtgagtttataatgactttaccatttcgtttatcta |
38082909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 548 - 649
Target Start/End: Original strand, 9993193 - 9993295
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtg--tgtgagtttataatggctttgccatttcgt |
645 |
Q |
| |
|
||||||| ||||||||||| |||||| | ||| | ||||||||||||||| |||||| |||| |||| |||||||||| ||| ||||| |||||||| |
|
|
| T |
9993193 |
aaaaatgtcgaaattgttaagccggacgtcataatcggggttcgaaccccagtacctcaactt-tgtgcatgtgagtttacgatgactttgtcatttcgt |
9993291 |
T |
 |
| Q |
646 |
ctat |
649 |
Q |
| |
|
|||| |
|
|
| T |
9993292 |
ctat |
9993295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 526 - 596
Target Start/End: Complemental strand, 10639730 - 10639663
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
596 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| |||||||| | ||||||| |||||||||||| |
|
|
| T |
10639730 |
agaagtcctagctcaactggcaaa---tgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
10639663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 622 - 654
Target Start/End: Complemental strand, 18778854 - 18778822
Alignment:
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
18778854 |
tttataatggctttgccatttcgtctatctacc |
18778822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 526 - 596
Target Start/End: Original strand, 19048758 - 19048825
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
596 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| |||||||| | ||||| | |||||||||||| |
|
|
| T |
19048758 |
agaagtcctagctcaactggcaaa---tgccgaaattgtaaggccggacgtcatgatccgggttcgaaccc |
19048825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 526 - 596
Target Start/End: Complemental strand, 33083678 - 33083611
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
596 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| |||||||| | ||||||| |||||||||||| |
|
|
| T |
33083678 |
agaagtcctagctcaactggcaaa---tgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
33083611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 42755196 - 42755297
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| | ||||| ||||| ||||| |||| |||||||| ||| |||||| | |||||||||||||| |||||||||| |||| ||||||||||| |
|
|
| T |
42755196 |
aaaatgtcaaaattattaggtcggatatgatgatcggggttcaaacatcggtacatccacttatgtgtgtg--tttataatggttttgtcatttcgtcta |
42755293 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
42755294 |
tcta |
42755297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 607 - 649
Target Start/End: Original strand, 7134564 - 7134606
Alignment:
| Q |
607 |
acttatgtgtgtgagtttataatggctttgccatttcgtctat |
649 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
7134564 |
acttatgtgtgtgagtttataacagttttgccatttcgtctat |
7134606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 624 - 654
Target Start/End: Original strand, 7588965 - 7588995
Alignment:
| Q |
624 |
tataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7588965 |
tataatggctttgccatttcgtctatctacc |
7588995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 556 - 654
Target Start/End: Original strand, 12448917 - 12449015
Alignment:
| Q |
556 |
cgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||| ||||| ||||| ||| ||||||| | |||||| |||| || |||||||||||||||| |||| || |||| |||||||||| |
|
|
| T |
12448917 |
cgaaattgttaggtcggatatcatgatcggcgttcgaattctagtacctcaacttgtgagtgtgagtttataatgactttaccctttcatctatctacc |
12449015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 558 - 652
Target Start/End: Complemental strand, 20955114 - 20955020
Alignment:
| Q |
558 |
aaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||| |||| ||| |||||| ||||||||| | |||| ||||||| |||||| |||||||||||||||| ||||| || ||||| |
|
|
| T |
20955114 |
aaattgttaggtcggacaccacgaccggagttcgaacctcaacacctctacttatgcgtgtgaatttataatggctttgcaatttcatcaatcta |
20955020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 577 - 654
Target Start/End: Complemental strand, 22382409 - 22382331
Alignment:
| Q |
577 |
catgaccggggttcgaaccccggtaccttcactta-tgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||| |||||||||||||||| |||| ||||| ||| ||||||||||| |||| |||| ||| ||||||||||||| |
|
|
| T |
22382409 |
catgatcggggttcgaaccccgacacctccactttgtgtatgtgagtttatgatggttttgtcatctcgtctatctacc |
22382331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 577 - 654
Target Start/End: Complemental strand, 22914435 - 22914357
Alignment:
| Q |
577 |
catgaccggggttcgaaccccggtaccttcactta-tgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||| |||||||||||||||| |||| ||||| ||| ||||||||||| |||| |||| ||| ||||||||||||| |
|
|
| T |
22914435 |
catgatcggggttcgaaccccgacacctccactttgtgtatgtgagtttatgatggttttgtcatctcgtctatctacc |
22914357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 548 - 649
Target Start/End: Original strand, 43691111 - 43691213
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggc-tttgccatttcgtc |
646 |
Q |
| |
|
||||||||||||||| ||| | | ||||| |||| || |||||||| ||| ||||| ||||||||| |||||||||| ||| | |||| ||||||||| |
|
|
| T |
43691111 |
aaaaatgccgaaattattaagtcagatgctatgatcgatgttcgaactccgatacctccacttatgtatgtgagtttaaaataacttttgacatttcgtc |
43691210 |
T |
 |
| Q |
647 |
tat |
649 |
Q |
| |
|
||| |
|
|
| T |
43691211 |
tat |
43691213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 605 - 654
Target Start/End: Original strand, 4190394 - 4190443
Alignment:
| Q |
605 |
tcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||| |||||||| |||| ||||||||||||||||| |
|
|
| T |
4190394 |
tcacttatgtgtgtgaatttataatcagtttgtcatttcgtctatctacc |
4190443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 583 - 652
Target Start/End: Original strand, 29095395 - 29095464
Alignment:
| Q |
583 |
cggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||| || ||| |||| |||||||||| |||||||||| | ||| ||||||| || ||||| |
|
|
| T |
29095395 |
cggggttcgaacctcgatacattcatttatgtgtgtaagtttataattgttttaccatttcatcaatcta |
29095464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 549 - 598
Target Start/End: Original strand, 44765248 - 44765297
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccg |
598 |
Q |
| |
|
|||||| ||||||||||||| ||||| ||||| |||||||||||||||| |
|
|
| T |
44765248 |
aaaatgtcgaaattgttaggttggatgtcatgatcggggttcgaaccccg |
44765297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 103; Significance: 8e-51; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 103; E-Value: 8e-51
Query Start/End: Original strand, 521 - 654
Target Start/End: Original strand, 160445 - 160578
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| |||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
160445 |
tatccagaagtcctagctcaactggtaaaa-atgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtgccttcacttgtgtgtgtga |
160543 |
T |
 |
| Q |
621 |
g-tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||| |
|
|
| T |
160544 |
gttttataatggctttgccatttcgtctatctacc |
160578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 102; Significance: 3e-50; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 102; E-Value: 3e-50
Query Start/End: Original strand, 522 - 654
Target Start/End: Complemental strand, 39442 - 39312
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| |||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
39442 |
atccagaagtcctagctcaactggtaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
39345 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
39344 |
tttataatggcttttccatttcgtctatctacc |
39312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0595 (Bit Score: 100; Significance: 5e-49; HSPs: 1)
Name: scaffold0595
Description:
Target: scaffold0595; HSP #1
Raw Score: 100; E-Value: 5e-49
Query Start/End: Original strand, 522 - 652
Target Start/End: Original strand, 344 - 472
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| ||||||||||||| ||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
344 |
atccaaaagtcctagctcaactggcaata--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgag |
441 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
442 |
tttataatggctttgccatttcgtctatcta |
472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0013 (Bit Score: 98; Significance: 8e-48; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 98; E-Value: 8e-48
Query Start/End: Original strand, 521 - 653
Target Start/End: Original strand, 90567 - 90697
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||||| |||| ||||| |||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
90567 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggcctgatgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgtga |
90664 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
90665 |
gtttataatggctttgccatttcgtctatctac |
90697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0515 (Bit Score: 93; Significance: 8e-45; HSPs: 1)
Name: scaffold0515
Description:
Target: scaffold0515; HSP #1
Raw Score: 93; E-Value: 8e-45
Query Start/End: Original strand, 521 - 652
Target Start/End: Original strand, 2476 - 2605
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||| || |||| ||| ||||| || ||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2476 |
tatccagaagtcataactcaactgacaaaa--tgtcgaaattgttaggccggatgctatgaccggggttcgaaccccggtacctccacttatgtgtgtga |
2573 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2574 |
gtttataatggctttgccatttcgtctatcta |
2605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0432 (Bit Score: 93; Significance: 8e-45; HSPs: 1)
Name: scaffold0432
Description:
Target: scaffold0432; HSP #1
Raw Score: 93; E-Value: 8e-45
Query Start/End: Original strand, 522 - 652
Target Start/End: Original strand, 9366 - 9495
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |||||||||| |
|
|
| T |
9366 |
atccagaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcctccacttgtgtgtgtgag |
9463 |
T |
 |
| Q |
622 |
-tttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |
|
|
| T |
9464 |
ttttataatggctttgccatttcatctatcta |
9495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0306 (Bit Score: 93; Significance: 8e-45; HSPs: 1)
Name: scaffold0306
Description:
Target: scaffold0306; HSP #1
Raw Score: 93; E-Value: 8e-45
Query Start/End: Original strand, 521 - 652
Target Start/End: Original strand, 2476 - 2605
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||| || |||| ||| ||||| || ||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2476 |
tatccagaagtcataactcaactgacaaaa--tgtcgaaattgttaggccggatgctatgaccggggttcgaaccccggtacctccacttatgtgtgtga |
2573 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2574 |
gtttataatggctttgccatttcgtctatcta |
2605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0778 (Bit Score: 91; Significance: 1e-43; HSPs: 1)
Name: scaffold0778
Description:
Target: scaffold0778; HSP #1
Raw Score: 91; E-Value: 1e-43
Query Start/End: Original strand, 526 - 654
Target Start/End: Original strand, 821 - 948
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag-ttt |
624 |
Q |
| |
|
||||||||||||||| ||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |||||||||| ||| |
|
|
| T |
821 |
agaagtcctagctcaactggcaaaa--tgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcctccacttgtgtgtgtgagtttt |
918 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
919 |
ataatggctttgccatttcgtctatctacc |
948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0457 (Bit Score: 90; Significance: 5e-43; HSPs: 1)
Name: scaffold0457
Description:
Target: scaffold0457; HSP #1
Raw Score: 90; E-Value: 5e-43
Query Start/End: Original strand, 526 - 654
Target Start/End: Original strand, 6782 - 6908
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||| ||||||||| ||||||||||||||| |||| |
|
|
| T |
6782 |
agaagtcctagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgaccggggttcgaactccggtacctccacttatgtgtgtgaattta |
6879 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||| ||||| |||||||||||||||||| |
|
|
| T |
6880 |
taatagctttaccatttcgtctatctacc |
6908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0061 (Bit Score: 85; Significance: 5e-40; HSPs: 1)
Name: scaffold0061
Description:
Target: scaffold0061; HSP #1
Raw Score: 85; E-Value: 5e-40
Query Start/End: Original strand, 522 - 645
Target Start/End: Complemental strand, 8988 - 8867
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||| ||||||| ||||||||| ||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8988 |
atccagaagtcatagctcaactggcaaaa--tgccgaaattgttaggccggatgtcatgaccgaggttcgaaccccggtaccttcacttgtgtgtgtgag |
8891 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgt |
645 |
Q |
| |
|
|||| ||||||||| ||||||||| |
|
|
| T |
8890 |
tttaaaatggctttaccatttcgt |
8867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0244 (Bit Score: 84; Significance: 2e-39; HSPs: 1)
Name: scaffold0244
Description:
Target: scaffold0244; HSP #1
Raw Score: 84; E-Value: 2e-39
Query Start/End: Original strand, 522 - 652
Target Start/End: Complemental strand, 7886 - 7758
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||| ||||||| |||||||| ||||||||||||||| |||||| |||||||||||||||||||||| ||||| ||||| |||||||||| |
|
|
| T |
7886 |
atccagaagtcttagctcaattggcaaaa--tgccgaaattgttagatcggatgtcatgaccggggttcgaaccccgatacctccacttgtgtgtgtgag |
7789 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7788 |
tttataatggctttgccatttcgtctatcta |
7758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0882 (Bit Score: 79; Significance: 2e-36; HSPs: 1)
Name: scaffold0882
Description:
Target: scaffold0882; HSP #1
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 527 - 652
Target Start/End: Complemental strand, 3821 - 3698
Alignment:
| Q |
527 |
gaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttat |
626 |
Q |
| |
|
|||||| ||||||| ||||||||| |||||||||||||||||||||||| ||||| ||||||||||||| |||||| ||||| ||||||||||||||| |
|
|
| T |
3821 |
gaagtcttagctcaactggcaaaa--tgccgaaattgttaggccggatgctatgactggggttcgaacccttgtacctccacttgtgtgtgtgagtttat |
3724 |
T |
 |
| Q |
627 |
aatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||| ||||||||||||||||||||| |
|
|
| T |
3723 |
aatgactttgccatttcgtctatcta |
3698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 79; Significance: 2e-36; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 521 - 653
Target Start/End: Complemental strand, 4145 - 4014
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||| ||||||||||||||| ||||||||||||||||| ||| ||||| ||||||| | |
|
|
| T |
4145 |
tatccagaagtcctagctcaactggcaaaa--tgccgaaattgttaagccggatgccatgactggggttcgaaccccggtgcctccacttgtgtgtgtaa |
4048 |
T |
 |
| Q |
621 |
g-tttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
| ||||||||||||||| ||||||| |||||||| |
|
|
| T |
4047 |
gttttataatggctttgtcatttcgcctatctac |
4014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 73; Significance: 7e-33; HSPs: 1)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 73; E-Value: 7e-33
Query Start/End: Original strand, 521 - 652
Target Start/End: Original strand, 64281 - 64410
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtga |
620 |
Q |
| |
|
|||||| || |||||||||| ||| | ||||| | ||||||||||||||||||||||||||||| ||||||||||| |||||| ||||| ||||||||| |
|
|
| T |
64281 |
tatccataaatcctagctcaactg--ataaaattctgaaattgttaggccggatgccatgaccggagttcgaaccccagtacctccacttgtgtgtgtga |
64378 |
T |
 |
| Q |
621 |
gtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||| |
|
|
| T |
64379 |
gtttataatgactttgtcatttcgtctatcta |
64410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 73; Significance: 7e-33; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 73; E-Value: 7e-33
Query Start/End: Original strand, 522 - 650
Target Start/End: Original strand, 195739 - 195866
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||||||||||||| ||| || ||||||| || ||||||||||||||||||| |||||| ||||||||||||||||| ||| ||||| |||||||||| |
|
|
| T |
195739 |
atccagaagtcctagttcaactagcaaaaa-tgtcgaaattgttaggccggatttcatgactggggttcgaaccccggttcctccacttgtgtgtgtgag |
195837 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatc |
650 |
Q |
| |
|
||||||||| ||||| ||||||||||||| |
|
|
| T |
195838 |
tttataatgactttgtcatttcgtctatc |
195866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122 (Bit Score: 70; Significance: 4e-31; HSPs: 2)
Name: scaffold0122
Description:
Target: scaffold0122; HSP #1
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 526 - 654
Target Start/End: Original strand, 18058 - 18184
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
|||||||||| |||| ||||||||| | |||||||||||| |||||||||||||| ||||||| |||||||| ||||| ||||||| |||| |||||| |
|
|
| T |
18058 |
agaagtcctacctcaactggcaaaata--ccgaaattgttaagccggatgccatgatcggggtttgaaccccgatacctccacttataagtgtaagttta |
18155 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||||||||||||| ||||||| |
|
|
| T |
18156 |
taatggctttgccatttcgtcaatctacc |
18184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122; HSP #2
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 526 - 653
Target Start/End: Complemental strand, 15721 - 15612
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttta |
625 |
Q |
| |
|
||||||||||| ||| ||||||||| |||||||||||||||| |||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
15721 |
agaagtcctagttcaactggcaaaa--tgccgaaattgttaggtcggatgccatga--------------ccggtaccttcactta--tgtgtgagttta |
15640 |
T |
 |
| Q |
626 |
taatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||| |||| |||||||||||||||| |
|
|
| T |
15639 |
taatggttttgtcatttcgtctatctac |
15612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0364 (Bit Score: 69; Significance: 2e-30; HSPs: 1)
Name: scaffold0364
Description:
Target: scaffold0364; HSP #1
Raw Score: 69; E-Value: 2e-30
Query Start/End: Original strand, 549 - 649
Target Start/End: Original strand, 12002 - 12102
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| ||||||| |||| |||||||||||||||| ||||||||| |||||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12002 |
aaaatgtcgaaattattagaccggatgccatgaccgatgttcgaacctcggtaccttcacttgtgtgtgtgagtttataatggctttgccttttcgtcta |
12101 |
T |
 |
| Q |
649 |
t |
649 |
Q |
| |
|
| |
|
|
| T |
12102 |
t |
12102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 66; Significance: 1e-28; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 66; E-Value: 1e-28
Query Start/End: Original strand, 549 - 654
Target Start/End: Original strand, 411672 - 411777
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| | ||||||||||| |||||| ||||||||||||||||||||| |||||| ||||| ||||||||| |||||||||||||||||||||||| || |
|
|
| T |
411672 |
aaaatgtcaaaattgttaggtcggatgtcatgaccggggttcgaaccccagtacctccacttgtgtgtgtgattttataatggctttgccatttcgttta |
411771 |
T |
 |
| Q |
649 |
tctacc |
654 |
Q |
| |
|
||||| |
|
|
| T |
411772 |
cctacc |
411777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0633 (Bit Score: 63; Significance: 6e-27; HSPs: 1)
Name: scaffold0633
Description:
Target: scaffold0633; HSP #1
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 528 - 652
Target Start/End: Complemental strand, 3918 - 3795
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcactt-atgtgtgtgagtttat |
626 |
Q |
| |
|
||||||||||||| |||| |||| |||||||||||||||| ||| | ||||| ||||||||||| ||||||||||||| || |||||||||||||||| |
|
|
| T |
3918 |
aagtcctagctcaactggtaaaa--tgccgaaattgttaggttggacgtcatgatcggggttcgaatcccggtaccttcattttatgtgtgtgagtttat |
3821 |
T |
 |
| Q |
627 |
aatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||| |||| ||||||||||||||| |
|
|
| T |
3820 |
aatggttttgtcatttcgtctatcta |
3795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 62; Significance: 2e-26; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 549 - 652
Target Start/End: Complemental strand, 93072 - 92970
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacct-tcacttatgtgtgtgagtttataatggctttgccatttcgtct |
647 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| ||||| |||| ||||| |
|
|
| T |
93072 |
aaaatgccgaaattattaggctggatgccatgaccggggttcgaaccccggtacctcccact--tgtgtgtgagtttataatgcctttgtcattccgtct |
92975 |
T |
 |
| Q |
648 |
atcta |
652 |
Q |
| |
|
||||| |
|
|
| T |
92974 |
atcta |
92970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 61; Significance: 1e-25; HSPs: 2)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 61; E-Value: 1e-25
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 95173 - 95277
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag-tttataatggctttgccatttcgtct |
647 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| ||||| | |||||||| ||||||||||| | ||||||||| |||||||||||||||| |
|
|
| T |
95173 |
aaaatgccgaaattgttaggccggatgccatggtcggggtttgaacctcaataccttcatttatgtgtgtgggttttataatgactttgccatttcgtct |
95272 |
T |
 |
| Q |
648 |
atcta |
652 |
Q |
| |
|
||||| |
|
|
| T |
95273 |
atcta |
95277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036; HSP #2
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 556 - 652
Target Start/End: Original strand, 51653 - 51749
Alignment:
| Q |
556 |
cgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||| ||||||| |||| || ||||||||| ||| ||||| ||| ||||| | |||||||||||||| |||| ||||| |||||||| |
|
|
| T |
51653 |
cgaaattgttataccggatgttatgatcgaggttcgaactccgatacctgcacgtatgtttatgagtttataatggttttgttatttcatctatcta |
51749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0163 (Bit Score: 60; Significance: 4e-25; HSPs: 2)
Name: scaffold0163
Description:
Target: scaffold0163; HSP #1
Raw Score: 60; E-Value: 4e-25
Query Start/End: Original strand, 521 - 652
Target Start/End: Complemental strand, 27047 - 26916
Alignment:
| Q |
521 |
tatccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtg--tgt |
618 |
Q |
| |
|
|||||| |||| |||||||| ||||||||| ||| |||||||||||||||||||||||||| | ||| |||||| ||||||| |||||||||| ||| |
|
|
| T |
27047 |
tatccataagttctagctcaactggcaaaa--tgcagaaattgttaggccggatgccatgactagagtttgaaccctggtacctccacttatgtgtgtgt |
26950 |
T |
 |
| Q |
619 |
gagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||||||| || |||||||| |||||||| |
|
|
| T |
26949 |
gagtttataatggattcgccatttcttctatcta |
26916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0163; HSP #2
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 551 - 652
Target Start/End: Complemental strand, 5574 - 5473
Alignment:
| Q |
551 |
aatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatc |
650 |
Q |
| |
|
|||||||||||||||| | |||||| ||||| ||||||| |||||| | ||||| ||||| ||||||||||||||||||| || | ||||||||||||| |
|
|
| T |
5574 |
aatgccgaaattgttatgtcggatgtcatgatcggggtttgaaccctgatacctccacttgtgtgtgtgagtttataatgaattcgacatttcgtctatc |
5475 |
T |
 |
| Q |
651 |
ta |
652 |
Q |
| |
|
|| |
|
|
| T |
5474 |
ta |
5473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0795 (Bit Score: 58; Significance: 6e-24; HSPs: 1)
Name: scaffold0795
Description:
Target: scaffold0795; HSP #1
Raw Score: 58; E-Value: 6e-24
Query Start/End: Original strand, 549 - 650
Target Start/End: Original strand, 1084 - 1185
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||| ||||||| |||||| |||||||| | ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1084 |
aaaatgccgaaattgttaggtcggatgttatgactggggttccaaccccaataccttcatgtgtgtgtgtgagtttataatgactttgccatttcgtcta |
1183 |
T |
 |
| Q |
649 |
tc |
650 |
Q |
| |
|
|| |
|
|
| T |
1184 |
tc |
1185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0070 (Bit Score: 57; Significance: 2e-23; HSPs: 1)
Name: scaffold0070
Description:
Target: scaffold0070; HSP #1
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 42076 - 42177
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||| ||||||||||||||||||| || ||| ||||||||||||||||| ||||||||||||| || || |
|
|
| T |
42076 |
aaaatgccaaaattgttaggccggacgccatgatcggggttcgaaccccggtatctctact--tgtgtgtgagtttataacggctttgccattttgttta |
42173 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
42174 |
tcta |
42177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0242 (Bit Score: 56; Significance: 9e-23; HSPs: 2)
Name: scaffold0242
Description:
Target: scaffold0242; HSP #1
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 525 - 654
Target Start/End: Original strand, 15060 - 15185
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||| ||||||| ||| | ||||||||||||||||||||||| ||| |||||||| |||||||||| | |||||| |||| |||||||| |||| |
|
|
| T |
15060 |
cagaagtcttagctcaactg--ataaaatgccgaaattgttaggccgaatgtcatgaccgaggttcgaacctctgtacctccact--tgtgtgtgtgttt |
15155 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||| ||||| |||||||||| |||||| |
|
|
| T |
15156 |
ataatgactttgtcatttcgtctttctacc |
15185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0242; HSP #2
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 525 - 654
Target Start/End: Original strand, 23895 - 24020
Alignment:
| Q |
525 |
cagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagttt |
624 |
Q |
| |
|
|||||||| ||||||| ||| | ||||||||||||||||||||||| ||| |||||||| |||||||||| | |||||| |||| |||||||| |||| |
|
|
| T |
23895 |
cagaagtcttagctcaactg--ataaaatgccgaaattgttaggccgaatgtcatgaccgaggttcgaacctctgtacctccact--tgtgtgtgtgttt |
23990 |
T |
 |
| Q |
625 |
ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||| ||||| |||||||||| |||||| |
|
|
| T |
23991 |
ataatgactttgtcatttcgtctttctacc |
24020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0502 (Bit Score: 53; Significance: 6e-21; HSPs: 1)
Name: scaffold0502
Description:
Target: scaffold0502; HSP #1
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 585 - 653
Target Start/End: Original strand, 10575 - 10643
Alignment:
| Q |
585 |
gggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctac |
653 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
10575 |
gggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccattacgtatatctac |
10643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0548 (Bit Score: 45; Significance: 3e-16; HSPs: 2)
Name: scaffold0548
Description:
Target: scaffold0548; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 548 - 616
Target Start/End: Original strand, 6771 - 6838
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgt |
616 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||||||||||| ||||||||| ||||| ||||| |
|
|
| T |
6771 |
aaaaatgccgaaattgttaggccggatgtcatga-cggggttcgaactccggtacctccacttgtgtgt |
6838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0548; HSP #2
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 549 - 652
Target Start/End: Original strand, 8123 - 8225
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtcta |
648 |
Q |
| |
|
|||||| ||| ||||||| | |||||| ||||| | |||| | |||||| ||||| |||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
8123 |
aaaatgtcgatattgttaagtcggatgtcatgatcaaggtttgcaccccg-tacctccacttatgtgtgtgagtttataatggctttacaatttcgtcta |
8221 |
T |
 |
| Q |
649 |
tcta |
652 |
Q |
| |
|
|||| |
|
|
| T |
8222 |
tcta |
8225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0530 (Bit Score: 45; Significance: 3e-16; HSPs: 1)
Name: scaffold0530
Description:
Target: scaffold0530; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 573 - 652
Target Start/End: Complemental strand, 8657 - 8581
Alignment:
| Q |
573 |
atgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
||||||||| ||| ||||||| || |||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
8657 |
atgccatgatcggagttcgaatcc-ggtaccttcacttatgtgtg--agtttataatggctttgccatttcgtcaatcta |
8581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0223 (Bit Score: 44; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 548 - 650
Target Start/End: Original strand, 22943 - 23046
Alignment:
| Q |
548 |
aaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcac-ttatgtgtgtgagtttataatggctttgccatttcgtc |
646 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||| | || |||||||||||||||| ||| || ||||| ||||||||| |||| |||| ||| |||| |
|
|
| T |
22943 |
aaaaatgccgaaattgttaggccggacgtcatgactgaggatcgaaccccggtacctccactttgtgtgtttgagtttatgatggttttgtcatcccgtc |
23042 |
T |
 |
| Q |
647 |
tatc |
650 |
Q |
| |
|
|||| |
|
|
| T |
23043 |
tatc |
23046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0204 (Bit Score: 44; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0204
Description:
Target: scaffold0204; HSP #1
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 522 - 652
Target Start/End: Original strand, 2753 - 2881
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgag |
621 |
Q |
| |
|
||||| ||||| ||||||| ||| ||||| || ||| |||||||| | |||| |||||| ||||||||||| | ||||| ||||||||||||| || |
|
|
| T |
2753 |
atccacaagtcgtagctcaactgacaaaacat--cgagattgttagatcagatgtcatgactggggttcgaactttgatacctccacttatgtgtgtaag |
2850 |
T |
 |
| Q |
622 |
tttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||| ||||||||| |||||||||||||||| |
|
|
| T |
2851 |
tttacaatggctttaccatttcgtctatcta |
2881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0131 (Bit Score: 44; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0131
Description:
Target: scaffold0131; HSP #1
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 571 - 654
Target Start/End: Complemental strand, 29943 - 29861
Alignment:
| Q |
571 |
ggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||| || ||||||||||||| || | ||||| ||||| |||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
29943 |
ggatgcaatcaccggggttcgaatcc-gatacctccacttgtgtgtgtgggtttataatggctttgccatttcgactatctacc |
29861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 44; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 583 - 654
Target Start/End: Original strand, 27930 - 28001
Alignment:
| Q |
583 |
cggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||| |||||| |||||| ||||| | |||||||| |
|
|
| T |
27930 |
cggggttcgaaccccggtacctccacttgtgtgtgtgagttcataatgactttgctatttcatttatctacc |
28001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 38; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 568 - 652
Target Start/End: Original strand, 22125 - 22210
Alignment:
| Q |
568 |
gccggatgccatgaccggggttcgaaccccggtaccttcactta-tgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||| | ||||| |||||||||||||||| ||||| ||||| ||||||||||||||| ||| ||||| ||| ||||||||||| |
|
|
| T |
22125 |
gccggacgtcatgatcggggttcgaaccccgatacctccactttgtgtgtgtgagtttatgatgactttgtcatctcgtctatcta |
22210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0098 (Bit Score: 38; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0098
Description:
Target: scaffold0098; HSP #1
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 549 - 594
Target Start/End: Original strand, 4695 - 4740
Alignment:
| Q |
549 |
aaaatgccgaaattgttaggccggatgccatgaccggggttcgaac |
594 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4695 |
aaaatgccaaaattgttaagccggatgccatgaccggggttcgaac |
4740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 36; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 557 - 652
Target Start/End: Original strand, 2193 - 2288
Alignment:
| Q |
557 |
gaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgccatttcgtctatcta |
652 |
Q |
| |
|
|||||||||||| || |||||||||||| ||| |||| ||||||| ||||| ||||||||||||||||||| || ||||||| |||||||| |
|
|
| T |
2193 |
gaaattgttaggtcgaatgccatgaccgaagttttaaccttggtacctccacttgtgtgtgtgagtttataatgaattctccatttcatctatcta |
2288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0027 (Bit Score: 35; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 528 - 626
Target Start/End: Complemental strand, 19437 - 19341
Alignment:
| Q |
528 |
aagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttat |
626 |
Q |
| |
|
||||||||| ||| |||||||||| || ||||||||||||||||| | ||||| ||||||||||||||| ||||| || || ||||||| ||||||| |
|
|
| T |
19437 |
aagtcctagttcaactggcaaaaa-tgttgaaattgttaggccggacgtcatgattggggttcgaaccccgatacctcca-ttttgtgtgtaagtttat |
19341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0669 (Bit Score: 34; Significance: 0.000000001; HSPs: 1)
Name: scaffold0669
Description:
Target: scaffold0669; HSP #1
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 614 - 654
Target Start/End: Original strand, 7521 - 7562
Alignment:
| Q |
614 |
tgtgtgagttt-ataatggctttgccatttcgtctatctacc |
654 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7521 |
tgtgtgagttttataatggctttgccatttcgtctatctacc |
7562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1348 (Bit Score: 33; Significance: 0.000000005; HSPs: 1)
Name: scaffold1348
Description:
Target: scaffold1348; HSP #1
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 526 - 596
Target Start/End: Complemental strand, 986 - 919
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
596 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| |||||||| | ||||||| |||||||||||| |
|
|
| T |
986 |
agaagtcctagctcaactggcaaa---tgccgaaattgcaaggccggacgtcatgacccgggttcgaaccc |
919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0086 (Bit Score: 33; Significance: 0.000000005; HSPs: 1)
Name: scaffold0086
Description:
Target: scaffold0086; HSP #1
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 522 - 610
Target Start/End: Complemental strand, 36552 - 36466
Alignment:
| Q |
522 |
atccagaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcactt |
610 |
Q |
| |
|
||||| |||||| |||||| ||| ||||||| ||||||||||||||| | ||| ||||| |||| ||||||||||||||||| ||||| |
|
|
| T |
36552 |
atccacaagtcccagctcaattgg-aaaaaataccgaaattgttaggctg-atgacatgatcgggattcgaaccccggtacctccactt |
36466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 33; Significance: 0.000000005; HSPs: 1)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 526 - 596
Target Start/End: Original strand, 114256 - 114323
Alignment:
| Q |
526 |
agaagtcctagctcagctggcaaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccc |
596 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| |||||||| | ||||| | |||||||||||| |
|
|
| T |
114256 |
agaagtcctagctcaactggcaaa---tgccgaaattgtaaggccggacgtcatgatccgggttcgaaccc |
114323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 31; Significance: 0.00000008; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 558 - 612
Target Start/End: Original strand, 25422 - 25476
Alignment:
| Q |
558 |
aaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttat |
612 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||| || ||||| ||||||| |
|
|
| T |
25422 |
aaattgttaggccggataccatgattggggttcgaacctcgatacctccacttat |
25476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University