View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5477_high_1 (Length: 540)
Name: NF5477_high_1
Description: NF5477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5477_high_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 314 - 523
Target Start/End: Complemental strand, 18695522 - 18695313
Alignment:
| Q |
314 |
acaagttccaatgcaacatccatctacgaggttctattcaaccatggtcttccaatgggaattttcccaaagggtgtaaacgagttcaacgttggtgaag |
413 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18695522 |
acaagttccaatgcaacatccatctacgaggttctattcaaccatggtcttccaatgggaattttcccaaagggtgtaaacgagttcaacgttggtgaag |
18695423 |
T |
|
| Q |
414 |
atggtaaattctgggtacatttagatcaagcatgtaacgcaaagtttgagaatgaattgcattatgatcgaaacgtttctgggtcattgagttatggaaa |
513 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18695422 |
atggtaaattctgggtacatttagatcaagcatgtaacgcaaagtttgagaatgaattgcattatgatcgaaacgtttctgggtcattgagttatggaaa |
18695323 |
T |
|
| Q |
514 |
gatcgatgct |
523 |
Q |
| |
|
|||||||||| |
|
|
| T |
18695322 |
gatcgatgct |
18695313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 21 - 77
Target Start/End: Complemental strand, 18695812 - 18695756
Alignment:
| Q |
21 |
aataccaataattgatcattctttgcctaatcccttctgtattcaagctgtcaaccc |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18695812 |
aataccaataattgatcattctttgcctaatcccttctgtattcaagctgtcaaccc |
18695756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University