View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5477_high_14 (Length: 239)
Name: NF5477_high_14
Description: NF5477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5477_high_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 28187148 - 28187263
Alignment:
| Q |
1 |
ttcaaatatgtgctaactcattagcgaagatttaacaataatcaagcataaaagcatatctaaagttacctaacaaaccccccggatccaaagatttaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
28187148 |
ttcaaatatgtgctaactcattagcgaagatttaacaatactcaagcataaaagcatatctaaagttacctaacaaaccccccggttccgaagatttaag |
28187247 |
T |
|
| Q |
101 |
gagatggttggtgttt |
116 |
Q |
| |
|
| |||||||||||||| |
|
|
| T |
28187248 |
gtgatggttggtgttt |
28187263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 117 - 222
Target Start/End: Original strand, 28187305 - 28187411
Alignment:
| Q |
117 |
cataacattgccatccttatctacaagagtata-ggggtgaatcgactaacataaccccagagcttctcgtaatcagcaagctcttccccggttaaacgg |
215 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
28187305 |
cataacattgtcatccttatctacaagagtataaggggtgaatcgactaacataaccccagagcttctcgtaatcagtaagctctttcccggttaaacgg |
28187404 |
T |
|
| Q |
216 |
tctaagg |
222 |
Q |
| |
|
||||||| |
|
|
| T |
28187405 |
tctaagg |
28187411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University