View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5477_low_11 (Length: 259)
Name: NF5477_low_11
Description: NF5477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5477_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 87; Significance: 9e-42; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 151 - 241
Target Start/End: Original strand, 13112677 - 13112767
Alignment:
| Q |
151 |
tatgacgttgaaggcatatttacattacacatgtttcttggtacatttgaaggttgttttctagtttactattaaaaaatcgatagctata |
241 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13112677 |
tatgatgttgaaggcatatttacattacacatgtttcttggtacatttgaaggttgttttctagtttactattaaaaaatcgatagctata |
13112767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 129 - 220
Target Start/End: Complemental strand, 6920199 - 6920109
Alignment:
| Q |
129 |
tattttgattgcagggataatatatgacgttgaaggcatatttacattacacatgtttcttggtacatttgaaggttgttttctagtttact |
220 |
Q |
| |
|
||||||||||||| ||||| ||||||| ||| ||||||| |||||||||||||||||||||| |||||| ||||||||| ||| |||||| |
|
|
| T |
6920199 |
tattttgattgcatggatattatatgatgttcaaggcat-tttacattacacatgtttcttgctacattcataggttgtttcctactttact |
6920109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 129 - 220
Target Start/End: Complemental strand, 6953369 - 6953279
Alignment:
| Q |
129 |
tattttgattgcagggataatatatgacgttgaaggcatatttacattacacatgtttcttggtacatttgaaggttgttttctagtttact |
220 |
Q |
| |
|
||||||||||||| ||||| ||||||| ||| ||||||| |||||||||||||||||||||| |||||| ||||||||| ||| |||||| |
|
|
| T |
6953369 |
tattttgattgcatggatattatatgatgtttaaggcat-tttacattacacatgtttcttgctacattcataggttgtttcctactttact |
6953279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 53 - 110
Target Start/End: Complemental strand, 18512016 - 18511959
Alignment:
| Q |
53 |
aattgttgatgctagcttgtttttatctagcactgaggcatactgtcacctgctgttt |
110 |
Q |
| |
|
||||||| |||||||||||| || |||||||||||| ||| ||||| |||||||||| |
|
|
| T |
18512016 |
aattgttaatgctagcttgtgttgatctagcactgaagcaaactgtgccctgctgttt |
18511959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University