View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5477_low_15 (Length: 236)
Name: NF5477_low_15
Description: NF5477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5477_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 14 - 220
Target Start/End: Complemental strand, 26019526 - 26019320
Alignment:
| Q |
14 |
ataatactcgagttcatctaatagtatcatactaggtcgaaacagtaggctaattcaactcacggtttgatccatcattcatactgggaaaacttttagt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26019526 |
ataatactcgagttcatctaatagtatcatactaggtcgaaacagtaggctaattcaactcacggtttgatccatcatccatactgggaaaacttttagt |
26019427 |
T |
 |
| Q |
114 |
gcaagaaagagtgaaacatgacataaatgagcattagcaacaaacacagcggaataaatnnnnnnncataaacaacgtcttcaagacttagcttaagtgg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
26019426 |
gcaagaaagagtgaaacatgacataaattagcattagcaacaaacacaacggaataaataaaaaaacataaacaacgtcttcaagacgtagcttaagtgg |
26019327 |
T |
 |
| Q |
214 |
ttgaact |
220 |
Q |
| |
|
||||||| |
|
|
| T |
26019326 |
ttgaact |
26019320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University