View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5478_high_65 (Length: 251)

Name: NF5478_high_65
Description: NF5478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5478_high_65
NF5478_high_65
[»] chr5 (1 HSPs)
chr5 (1-241)||(33162634-33162874)


Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 33162634 - 33162874
Alignment:
1 tagcttcatagcttcaagaggggttgttcctttatacatgagtatttcacaacggtttccnnnnnnngataacactttggatatagttcattccatgcat 100  Q
    ||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||       |||||||||||||||||||||||||||||||||    
33162634 tagcttcatagcttcaagaggggttcttcctttatatatgagtatttcacaacggtttccgttttttgataacactttggatatagttcattccatgcat 33162733  T
101 gttttgagtaattggataccagaaacattgcttcattttttgttgtttgatgtttatagggttcttagacctggtgggttgttttggttggaccatttct 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33162734 gttttgagtaattggataccagaaacattgcttcattttttgttgtttgatgtttatagggttcttagacctggtgggttgttttggttggaccatttct 33162833  T
201 tttgtgttggggatcaattggagaatgtttatggacctatg 241  Q
    |||||||||||||||||||||||||||||||||||||||||    
33162834 tttgtgttggggatcaattggagaatgtttatggacctatg 33162874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University