View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5478_high_79 (Length: 237)
Name: NF5478_high_79
Description: NF5478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5478_high_79 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 55 - 237
Target Start/End: Complemental strand, 16460301 - 16460119
Alignment:
| Q |
55 |
gcaggatggaatctgaacttcttgagaaaattgcaaaggatgtaatagaaaaactaaatcgagtaaatgatggtgacctagatcgtaagattgagaagat |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16460301 |
gcaggatggaatctgaacttcttgagaaaattgcaaaggatgtaatagaaaaactaaatcgagtaaatgatggtgacctagatcgtaagattgagaagat |
16460202 |
T |
 |
| Q |
155 |
catgaatcttgctaaactctaatatcaattctttcaaagcatttatagccttgaaaatttgaacaagtatcaagcaactattc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16460201 |
catgaatcttgctaaactctaatatcaattctttcaaagcatttatagccttgaaaatttgaacaagtatcaagcaactattc |
16460119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 56 - 138
Target Start/End: Complemental strand, 16499247 - 16499165
Alignment:
| Q |
56 |
caggatggaatctgaacttcttgagaaaattgcaaaggatgtaatagaaaaactaaatcgagtaaatgatggtgacctagatc |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| | |||||| |||||||||| ||| ||||||| |||||| |
|
|
| T |
16499247 |
caggatggaatctgaacttcttgagaaaattgcgaaggatgtattggaaaaattaaatcgagtttatgttggtgacttagatc |
16499165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University