View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5478_high_79 (Length: 237)

Name: NF5478_high_79
Description: NF5478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5478_high_79
NF5478_high_79
[»] chr5 (2 HSPs)
chr5 (55-237)||(16460119-16460301)
chr5 (56-138)||(16499165-16499247)


Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 55 - 237
Target Start/End: Complemental strand, 16460301 - 16460119
Alignment:
55 gcaggatggaatctgaacttcttgagaaaattgcaaaggatgtaatagaaaaactaaatcgagtaaatgatggtgacctagatcgtaagattgagaagat 154  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16460301 gcaggatggaatctgaacttcttgagaaaattgcaaaggatgtaatagaaaaactaaatcgagtaaatgatggtgacctagatcgtaagattgagaagat 16460202  T
155 catgaatcttgctaaactctaatatcaattctttcaaagcatttatagccttgaaaatttgaacaagtatcaagcaactattc 237  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16460201 catgaatcttgctaaactctaatatcaattctttcaaagcatttatagccttgaaaatttgaacaagtatcaagcaactattc 16460119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 56 - 138
Target Start/End: Complemental strand, 16499247 - 16499165
Alignment:
56 caggatggaatctgaacttcttgagaaaattgcaaaggatgtaatagaaaaactaaatcgagtaaatgatggtgacctagatc 138  Q
    ||||||||||||||||||||||||||||||||| ||||||||| | |||||| ||||||||||  ||| ||||||| ||||||    
16499247 caggatggaatctgaacttcttgagaaaattgcgaaggatgtattggaaaaattaaatcgagtttatgttggtgacttagatc 16499165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University