View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5478_high_81 (Length: 235)

Name: NF5478_high_81
Description: NF5478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5478_high_81
NF5478_high_81
[»] chr4 (1 HSPs)
chr4 (11-220)||(52511177-52511386)


Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 11 - 220
Target Start/End: Original strand, 52511177 - 52511386
Alignment:
11 tcattttgttctttgcttcttctggttaccaacttcaaaatcatttgttgaggaggttttccttgaagattggaatgggatggaggtggttttagcattc 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52511177 tcattttgttctttgcttcttctggttaccaacttcaaaatcatttgttgaggaggttttccttgaagattggaatgggatggaggtggttttagcattc 52511276  T
111 ttattgcagctggtgaagctctgcatcaccataggctttgtagtggcaacccaaggatcaccaggtatgtgcttgcttaatcttcacgttttgttgagat 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52511277 ttattgcagctggtgaagctctgcatcaccataggctttgtagtggcaacccaaggatcaccaggtatgtgcttgcttaatcttcacgttttgttgagat 52511376  T
211 tgatcctttg 220  Q
    ||||||||||    
52511377 tgatcctttg 52511386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University