View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5478_high_85 (Length: 227)
Name: NF5478_high_85
Description: NF5478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5478_high_85 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 19 - 211
Target Start/End: Complemental strand, 29180505 - 29180313
Alignment:
| Q |
19 |
aagtatggtgtcacgcaaaaatgtgtcaaataagttttggtcggaagcaatgaaatgggcaacttatatcttgaatatgagtcatgcattgttaattaag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || |||||||||||||| |
|
|
| T |
29180505 |
aagtatggtgtcacgcaaaaatgtgtcaaataagttttggtcggaagcaatgaaatgggcaacttatgccttgaatatgagttattcattgttaattaag |
29180406 |
T |
 |
| Q |
119 |
tatatcatacctgaagaagcatggagtggtataaaaccctgtgtgcacttgataactggaaaaatgtcggttattaccttgcatttatctccc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29180405 |
gatatcatacctgaagaagcatggagtggtataaaaccctgtgtgcacttgataactggaaaaatgtcggttattaccttgcatttatctccc |
29180313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 182 - 211
Target Start/End: Original strand, 28856305 - 28856334
Alignment:
| Q |
182 |
atgtcggttattaccttgcatttatctccc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
28856305 |
atgtcggttattaccttgcatttatctccc |
28856334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University