View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5478_high_86 (Length: 222)

Name: NF5478_high_86
Description: NF5478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5478_high_86
NF5478_high_86
[»] chr4 (1 HSPs)
chr4 (1-205)||(41289157-41289361)


Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 41289361 - 41289157
Alignment:
1 atatgccagcttccaaaataattcacacacgcagaaactggtcaattatgcaatttcagtcaactgtctaaaatatacccaactatacacagtgaatcgc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
41289361 atatgccagcttccaaaataattcacacacgcagaaactggtcaattatgcaatttcaatcaactgtctaaaatatacccaactatacacagtgaatcgc 41289262  T
101 taatttagtccctaaagttatagagtcgaacaactttttcttttggtttctcataggttccctcttcaatagttgtaattttattcgagaaactctcact 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41289261 taatttagtccctaaagttatagagtcgaacaactttttcttttggtttctcataggttccctcttcaatagttgtaattttattcgagaaactctcact 41289162  T
201 aaatg 205  Q
    |||||    
41289161 aaatg 41289157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University