View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5478_high_87 (Length: 222)
Name: NF5478_high_87
Description: NF5478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5478_high_87 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 95 - 222
Target Start/End: Original strand, 2785330 - 2785457
Alignment:
| Q |
95 |
gacaatggtggcttagttacaaccatctccttaggaaaaatcatcccaatcaagcggtaaggtttgtctgaaacagacattagcaacgtctgtgatggca |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2785330 |
gacaatggtggcttagttacaaccatctccttaggaaaaatcatcccgatcaagcggcaaggtttgtctgaaacagacattagcaacgtctgtgatggca |
2785429 |
T |
 |
| Q |
195 |
attgaataactgcacattgcttcttttc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
2785430 |
attgaataactgcacattgcttcttttc |
2785457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 52; Significance: 6e-21; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 127 - 210
Target Start/End: Complemental strand, 22525589 - 22525506
Alignment:
| Q |
127 |
aggaaaaatcatcccaatcaagcggtaaggtttgtctgaaacagacattagcaacgtctgtgatggcaattgaataactgcaca |
210 |
Q |
| |
|
|||||||| |||||| ||||||||| | | ||||||||| ||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
22525589 |
aggaaaaagcatcccgatcaagcggcaggctttgtctgacacagatagtagcaacgtctgtgatggcaattgaataactgcaca |
22525506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 127 - 210
Target Start/End: Complemental strand, 22531462 - 22531379
Alignment:
| Q |
127 |
aggaaaaatcatcccaatcaagcggtaaggtttgtctgaaacagacattagcaacgtctgtgatggcaattgaataactgcaca |
210 |
Q |
| |
|
|||||||| || ||| ||||||||| | | ||||||||| ||||| | |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
22531462 |
aggaaaaagcacccccatcaagcggcaggctttgtctgacacagatagtagcaacgtctgtgattgcaattgaataactgcaca |
22531379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 130 - 210
Target Start/End: Complemental strand, 22534770 - 22534687
Alignment:
| Q |
130 |
aaaaatcatcccaatcaagcggta--aggtt-tgtctgaaacagacattagcaacgtctgtgatggcaattgaataactgcaca |
210 |
Q |
| |
|
||||| |||||||||||||||| | ||| | |||| |||||||| | |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
22534770 |
aaaaagcatcccaatcaagcggcagcaggctatgtcagaaacagatagtagcaaagtctgtgatggcaattgaataactgcaca |
22534687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 209
Target Start/End: Original strand, 29438615 - 29438697
Alignment:
| Q |
127 |
aggaaaaatcatcccaatcaagcggtaaggtttgtctgaaacagacattagcaacgtctgtgatggcaattgaataactgcac |
209 |
Q |
| |
|
||||| || |||||||||||| ||| ||||| || |||||| | | ||||| |||||||||||||||||||||||||||| |
|
|
| T |
29438615 |
aggaataaacatcccaatcaactggttgggtttttcagaaacaaatagcagcaatgtctgtgatggcaattgaataactgcac |
29438697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University