View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5478_high_91 (Length: 216)
Name: NF5478_high_91
Description: NF5478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5478_high_91 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 33162291 - 33162498
Alignment:
| Q |
1 |
ccttcccttctagtctctggtccacaccctcaaactcctccgtcgtgtggaccgcttacacatgcaaatcctacacatgtctcattgaccgttcccgcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33162291 |
ccttcccttctagtctctggtccacaccctcaaactcctcagtcgtgtggaccgcttacacatgcaaatcctacacatgtctcattgaccgttcccgcac |
33162390 |
T |
|
| Q |
101 |
tcagagaggctttgatgattgtaaagactgttttgatctcaacggccgggagaagcaccgttggacaaaccctagatcgaaaggtctagatttcagtatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
33162391 |
gcagagaggctttgatgattgtaaagactgttttgatctcaacggccgtgagaagcaccgttggacaaaccctagatcaaacggtctagatttcagtatc |
33162490 |
T |
|
| Q |
201 |
gatgatgt |
208 |
Q |
| |
|
|| ||||| |
|
|
| T |
33162491 |
gacgatgt |
33162498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University