View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5478_high_92 (Length: 209)

Name: NF5478_high_92
Description: NF5478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5478_high_92
NF5478_high_92
[»] chr4 (1 HSPs)
chr4 (19-195)||(29583364-29583540)


Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 19 - 195
Target Start/End: Complemental strand, 29583540 - 29583364
Alignment:
19 ctttgcacccttcaaatatttgcttaactaataattgcacctcttcttctcgaacttctgtgaacatcgcaagacgattggtggagaaaagttctgttgt 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
29583540 ctttgcacccttcaaatatttgcttaactaataattgcacctcttcttctcgaacttttgtgaacatcgcaagacgattggtggagaaaagttctgttgt 29583441  T
119 tgttaaacgacgtagtttgcgatgaagttcaccgtagggagaaaaccctaacgccgtattattgtaattgagatatt 195  Q
    |||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29583440 tgttaaacgacgcaatttgcgatgaagttcaccgtagggagaaaaccctaacgccgtattattgtaattgagatatt 29583364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University