View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5478_low_28 (Length: 367)
Name: NF5478_low_28
Description: NF5478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5478_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 2e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 203 - 356
Target Start/End: Complemental strand, 41866319 - 41866166
Alignment:
| Q |
203 |
gattgttgatttatctctattctttattgaagcctctttgttgatgcagaacaaaataccataactgcttgcaataccatccttgtacgtttgaatttta |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41866319 |
gattgttgatttatctctattctttattgaagcctctttgttgatgcagaacaaaataccataactgcttgcaataccatccctgtacgtttgaatttta |
41866220 |
T |
|
| Q |
303 |
ctcttttccattctatccaatgtgaaatcaatttgtgtatctttttatctctct |
356 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
41866219 |
ctcttttccattctatccaatgtgaaaacagtttgtgtatctttttatctctct |
41866166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University