View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5478_low_48 (Length: 301)
Name: NF5478_low_48
Description: NF5478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5478_low_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 15 - 284
Target Start/End: Complemental strand, 53679531 - 53679262
Alignment:
| Q |
15 |
aaatagaacctaattgaattgattttacatgcttaatcaactcccttcatgattcttgaattgtttgattgaaagattggtaaaaagtttcaattttgtt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
53679531 |
aaatagaacctaattgaattgattttacatgcttaatcaactcccttcatgattcttgaattgtttgattgaaagattggtaaaaaatttcaattttgtt |
53679432 |
T |
 |
| Q |
115 |
caccacgtttaacgttttaaatatgtcatgtttcagttctgtttttaagctagttatattctggttcaatttcacttcttgttaaaacagttcagttagt |
214 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
53679431 |
caccatgtttaacgttttaaatatgttatgtttcagttttgtttttaagctagttatattctggttcaatttcagttcttgttaaaacagttcagttagt |
53679332 |
T |
 |
| Q |
215 |
aaccagaccttttcatatggttcagtctgaacatttataaaccagtttagtttaataacagtttggttca |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
53679331 |
aaccagaccttttcatatggttcagtctgaacatttataaaccagtttagttcaataacagtttggttca |
53679262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 196 - 240
Target Start/End: Original strand, 2045022 - 2045066
Alignment:
| Q |
196 |
ttaaaacagttcagttagtaaccagaccttttcatatggttcagt |
240 |
Q |
| |
|
|||||||||||||| || |||||| ||||||||||||||||||| |
|
|
| T |
2045022 |
ttaaaacagttcagctaataaccaatccttttcatatggttcagt |
2045066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University