View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5478_low_50 (Length: 297)
Name: NF5478_low_50
Description: NF5478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5478_low_50 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 82 - 280
Target Start/End: Complemental strand, 26840827 - 26840632
Alignment:
| Q |
82 |
agttgtcggatctggaatattcgaaccttgacgggatgcgacaatgaaattgggtcgaagacggagttgtatttggtggtgacagaggagagaggagatg |
181 |
Q |
| |
|
||||||||||||| |||| ||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26840827 |
agttgtcggatctagaatcttcgaacctcgacgggatgcgacggtgaaattgggtcgaagacggagttgtatttggtggtgacagaggagagaggagatg |
26840728 |
T |
|
| Q |
182 |
taggtgttgtcgccggcgagtcatgtt-ggtcgatgagaggagggaggaaatgaaaaggaaaccgatgatgaagtggcaactatcagtatgttcgaattg |
280 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |||||| ||||||| ||||||||||| |
|
|
| T |
26840727 |
taggtgttgtcgccggcgagtcatgttcggtcgatgagaggagggaggaaatgaaaaggaaactgatgataaagtgg----tatcagtgtgttcgaattg |
26840632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 82 - 280
Target Start/End: Complemental strand, 26840394 - 26840199
Alignment:
| Q |
82 |
agttgtcggatctggaatattcgaaccttgacgggatgcgacaatgaaattgggtcgaagacggagttgtatttggtggtgacagaggagagaggagatg |
181 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26840394 |
agttgtcggatctggaatcttcgaacctcgacggaatgcgaaggtgaaattgggtcgaagacggagttgtatttggtggtgacagaggaaagaggagatg |
26840295 |
T |
|
| Q |
182 |
taggtgttgtcgccggcgagtcatgtt-ggtcgatgagaggagggaggaaatgaaaaggaaaccgatgatgaagtggcaactatcagtatgttcgaattg |
280 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| ||||||||||| |
|
|
| T |
26840294 |
taggtgttgtcgccggcgagtcatgttcggtcgatgagaggagggaggaaatgaaaaggaaactgatgatgaagtgg----tatcagtgtgttcgaattg |
26840199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 15 - 105
Target Start/End: Complemental strand, 25490790 - 25490700
Alignment:
| Q |
15 |
tatgggtcgttagtgtgaagatggagagtcgatactacctcatccaacaattgtgcagaaggagggaagttgtcggatctggaatattcga |
105 |
Q |
| |
|
||||||| |||| ||||||||||||||| ||||||||||||| ||||||| || | ||||| |||| ||||||||| |||||| ||||| |
|
|
| T |
25490790 |
tatgggtggttattgtgaagatggagaggcgatactacctcagccaacaactgagaagaagaaggggcattgtcggatatggaatcttcga |
25490700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University